1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kirill115 [55]
3 years ago
12

Neurotransmitters transmit ____________ between ____________ , from neurons to glands, from neurons to organs, and from neurons

to muscles.
Biology
1 answer:
astraxan [27]3 years ago
3 0

Answer:

1. Nerve impulse

2. Neurons

Explanation:

Neurotransmitters are compounds with low molecular weight. They are secreted by axon terminals of the neurons. The released neurotransmitters then bind to the receptors located on next neuron or on the surface of muscle cell.

The function of neurotransmitters is to carry the nerve impulse from presynaptic neuron to the postsynaptic neuron or from neurons to the effector organs such as muscles and glands.  

For example, neurotransmitters are released into the synaptic cleft to transmit the nerve impulse between neurons.  

You might be interested in
Liverworts, like the ones shown here, are nonvascular plants. They do not grow tall. Explain how the tissues in liverworts affec
IgorC [24]

Answer: The tissue structure of the liverworts restricts them to a type of environment that affects their size.

Explanation:

Nonvascular plants, also called the Bryophytes in Kingdom Plantae, are simple plants that grow in damp places on land and as the name implies, are non vascular plants( that is, they lack vascular tissues). There are three types of nonvascular plants which includes:

--> Mosses

--> liverworts and

--> hornworts.

Liverworts are restricted to a particular size through the type of tissue they have ( non vascular) because it predisposes them to lack conducting vessels like the phloem and xylem found in vascular plants which aids in conducting water and food to various parts of the plants. Also they do not grow tall like the vascular plants because they lack the qualities that will enable them do so, such as roots, stems and leaves.

Nonvascular plants are low-growing, reproduce with spores, and need a moist or damp environment.

5 0
3 years ago
has four pairs of chromosomes what proportion of gametes would be expected to contain some chromosomes from both parental and ma
gogolik [260]

Answer:

To complete the question: a diploid organism has four pairs of chromosomes what proportion of gametes would be expected to contain some chromosomes from both parental and maternal origin? assume that there is no crossing over

Answer: 7/8

Explanation:

A diploid organism with four pairs of chromosomes...

Assume that the organism receives chromosomes A, B, C and D from the female parent and A', B', C' and D' from the male parent.

Proportion of gametes from patterns origin is the same as that of matters origin, this we have:

(1/2)^4 = 1/16 where 4 reps the number of possibilities, 1/2 rep the chance

Thus, the proportion of gametes expected to contain some chromosomes from both parental and maternal origin would be

(1 - (1/16 + 1/16)) = 14/16 = 7/8

3 0
3 years ago
AUUUAACUGUUCUGUCUAGAG
Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0
3 years ago
Can someone please help?
Nadusha1986 [10]
The answer you chose is correct becAuse if both parents are heterozygous for a disease that is recessive there is a 25%chance of the offspring inheriting the trait.Ex: R r R (RR) (Rr) r (Rr) (rr) rr is the only outcome that can inherit the disease.
4 0
3 years ago
When a person needs a gradual increase in the amount of a psychoactive drug to produce the desired effect, _____ has occurred.
Llana [10]

drug tollerance

When a person needs a gradual increase in the amount of a psychoactive drug to produce the desired effect, drug tollerance has occurred.

5 0
3 years ago
Other questions:
  • What type of catastrophic event, which left a slight crater in the Yucatan Peninsula and iridium rich soil nearby, is thought to
    12·2 answers
  • What are the layers of the atmosphere
    9·2 answers
  • Which organs are responsible for producing fluid to give sperm nourishment and motility?
    5·2 answers
  • Earth is not completely round due to its rotation.<br> True<br> False
    14·1 answer
  • Which dunes are formed under varying wind directions, but are dominantly parallel to the average direction?
    10·1 answer
  • Question 13 (4 points)
    14·1 answer
  • What is crossing over?
    8·1 answer
  • Whats the main part of a seedlings ​
    12·1 answer
  • Two reasons why we should try not cut down forest. ​
    10·1 answer
  • An organism in its niche within an ecosystem is similar to?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!