1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
labwork [276]
2 years ago
13

If a disease killed all the seagulls what effect would this have on the food web?

Biology
2 answers:
aliina [53]2 years ago
7 0

Answer and explanation: it would mean that there would be an increase of fish which is what seaguls eat but a decrease of, for example, leopard seals because if there aren't enough seagulls the leopard seals would die of starvation which would then again decrease another animal species because there aren't enough leopard seals. This would then repeat itself again and again.

Studentka2010 [4]2 years ago
3 0

Answer:

if the disease kills all the seaguells then it will affect the food chain negativleyy because the population of the species that would eat them (predator) will decrease dramatically and the fish ( what the seaguells eat ) there peopulation will increase dramatically because they are not being eaten .

Explanation:

hope this helps , sorry middle school was a long time ago for me : )

You might be interested in
Using the electron configuration flow diagram below, what is the correct electron configuration for nitrogen (atomic number 7)?
cluponka [151]

Answer:

I do not see the electron configuration flow diagram, but the full electron configuration for nitrogen is  1s^22s^22p^3

8 0
2 years ago
1) If you cross a mussel with dark, zebra-striped shells with a mussel with
irina1246 [14]
75% is my answer! I hope you get it right!
8 0
2 years ago
Read 2 more answers
A man who donates sperm to a sperm bank is maximizing his __________________ while minimizing his _____________. By shopping thr
hoa [83]

Answer:

inclusive fitness, parental investment, eugenics

Explanation:

: )

8 0
3 years ago
Read 2 more answers
The smallest, most specific classification level is
arlik [135]
A species is the smallest CLASSIFICATION level, then genus, family, order, class, phylum, and kingdom. Kingdoms are the most generalized and basic.
3 0
3 years ago
Read 2 more answers
Which is the most important benefit of studying fossils?
Zanzabum
Fossils give information about the time period in which organisms lived in the past.
6 0
2 years ago
Other questions:
  • How does carbon become locked inside the earth?
    12·1 answer
  • In the context of perception, _____ processing involves starting with a sense of what is happening and then applying that framew
    11·1 answer
  • 6. When humans first appear on Earth?
    5·1 answer
  • Which is biotic?
    14·2 answers
  • Can we cure cancer?why or why not
    5·1 answer
  • Names of cell organells​
    6·2 answers
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • I really need help this is due tomorrow and is gonna cause my to fail the class :(
    11·1 answer
  • From the types of light that reach Earth's surface, which do you think could be causing skin cancer?
    13·1 answer
  • What happens when Earth rotates on it's axis and how long does it take?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!