Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
The correct answer is option Complex neuroendocrine response.
Explanation:
Hypothalamus is the thermostat of the body as it regulates and maintains body temperature by responding to external signals or stimuli and adjusts the body temperature in a close one to two degree of 98.6 degree.
The regulation involves a different type of endocrine hormones and thyroid gland and receptors that help in signaling the increase or decrease of body temperature it involves neurons and hormones.
Due to the response of thermoreceptors and hormones is known as the neuroendocrine response. Hypothalamus Involves two or more hormones and several steps it known as a complex response.
Thus, the correct answer is a Complex neuroendocrine response.
Could you add the picture please?
Presumably whatever their nutrition and health requires, for instance, if a tree frog requires fruit flies to maintain a healthy and balanced diet, then the conservation center probably feeds their tree frogs fruit flies.
Skeletal system.
Without a proper skeleton, we would not have enough rigidity to properly move. We'd be an awkward pile of skin, muscle & bodily fluids.
Hope that helps!
