1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kumpel [21]
3 years ago
5

How is the meaning of theory in science different from the everyday use of the term

Biology
1 answer:
natka813 [3]3 years ago
5 0
In everyday use, theory is used to mean a guess or idea about how something works. In science we would call that a hypothesis not a theory. A scientific theory is a well sustained proposal or explanation based on facts that have been repeatedly confirmed through experiments and observations. To sum up, a theory in the real world is basically a guess, and a theory in the science world is a well though out plan that has been tested and a more intact thought.
You might be interested in
Why do some codons code for the same
ollegr [7]
Answer: B

Explanation: Multiple different combinations of bases (A, G, C, T) can code for the same amino acid. This means that there are more possible combinations of the bases than there are amino acids. There are 20 amino acids and the four bases can have up to 64 different codon combinations.
5 0
2 years ago
Which metamorphic process usually produces foliated rocks?
oee [108]
It is the first one heated


6 0
3 years ago
A population of 40 killer whales lives in a bay that measures 2000 square miles. What is the population density of killer whales
never [62]

Answer:

.02

Explanation:

When finding population density, divide the amount of people, animals or things in the region by the total square miles. 40/2000 is .02.

3 0
4 years ago
In our lives, we rarely experience temperatures that are above 373 K (100 °C) or below 273 K (0 °C). Investigate how much diffus
Mariulka [41]

Answer:

Global and I have been working for the last three years and have been working with a company based based on the following areas for big growth in the UK with the team in North

Explanation:

7am and the family will have a better understanding than the other in the UK or elsewhere in the UK or Europe and are not liable for any of the services or services that are in the UK next week and will also not have to pay for the distance and the family will also need a lot of information to help with the team to work with the team to work with the team to work with the team and provide a service for them in the workplace to the workplace as the service is not fully functioning properly and they will not be allowed to be charged for the service charge to the council tax and the council tax will not be paid for the council tax which is not covered by the council tax which is to be paid by the council tax and the council tax has been paid for the property to be paid by the council tax and the council tax has been paid for the property to be paid by the council tax and the council tax has been paid for the property to be paid by the council tax and the council tax has been paid for the property to be paid

6 0
3 years ago
What are the two main purposes of DNA?
Margaret [11]

Answer: To make protein and store hereditary information

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which technique is most accurate in identifying an appropriate vein site for iv catheter insertion into the arm?
    7·2 answers
  • All of the cells in the human body contain the same genes. How do cells have different morphologies and functions when they cont
    9·1 answer
  • what would happen if a mutation caused a stop codon to appear too early in the mRNA strain being translated by the ribosome?
    6·1 answer
  • When a plant produces sugars and transports them during translocation, which main plant tissues are at work?
    9·2 answers
  • True or False: Organisms are classified and placed into kingdoms based on their characteristics​
    5·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which type of cell does the strainer model?
    8·1 answer
  • What is a key feature of circulation?
    7·1 answer
  • BIOLOGY - QUARTER 2 - SUN
    14·1 answer
  • What is the only evidence we can get from a star?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!