1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mixer [17]
3 years ago
11

The ability to ______ pea plants allowed Mendel to study the offspring of two parents diffrent traits

Biology
2 answers:
RideAnS [48]3 years ago
5 0
Cross pollinate. by doing this he was able to study the pea plant offspring
Reptile [31]3 years ago
4 0
The answer is cross-pollinate
You might be interested in
What is Classification?<br><br>Take 50 points​
igor_vitrenko [27]

Answer:Classification, in biology, the establishment of a system of categories on the basis of presumed relationships among organisms. The science of biological classification is commonly called taxonomy.

4 0
3 years ago
To the base pair given write the correct matching base pair for
adelina 88 [10]

AT, GC

Explanation:

Adenine (A) pairs with Thymine (T).

Guanine (G) pairs with Cytosine (C).

A - T

C - G

T - A

T - A

G - C

C - G

hope this helps you!

5 0
3 years ago
It's 3 questions this time.
Vinvika [58]

Answer: 3.  in the icecaps. 2. temperature. 1.  the second one

Explanation:

6 0
3 years ago
Which of the following best explains a characteristic that differentiates fungi from animals?
kvv77 [185]
The correct answer is A.
Fungi can reproduce asexually while animals cannot.
3 0
3 years ago
Read 2 more answers
The body obtains sugar from food. Which system most directly affects blood sugar levels?
frozen [14]

Answer: digestive is the correct answer

5 0
3 years ago
Read 2 more answers
Other questions:
  • What was the possible function of the horns of the dinocephalian, and was this animal a herbivore or carnivore? question 4 optio
    7·1 answer
  • How do the leaves help trees survive in their respective biomes? A. The temperate leaves are broad and flat to maximize sunlight
    6·1 answer
  • A scientist is looking at a cell's membrane. she notices that the membrane is composed (primarily) of a certain type of macromol
    13·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which force is most responsible fo the formation of a star
    12·1 answer
  • What is not a necessity of life?
    9·1 answer
  • What are kidney stones? How do they form?
    8·2 answers
  • HELP, 100 POINTS!
    6·1 answer
  • Can one model demonstrate all outcomes of mitosis?
    11·2 answers
  • What are the best conditions for ginger root to grow?.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!