1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natta225 [31]
3 years ago
13

Which pair of organisms represent a predator-prey relationship?

Biology
1 answer:
lidiya [134]3 years ago
5 0
A pair of organisms which would represent a predator-prey relationship could be for example wolves and deer. The wolf in this case is of course the predator while the deer plays the role of prey. Wolves hunt deer and the latter then have to try and run away from being eaten by wolves. 
You might be interested in
Monocots and dicots are two groups of _____.
Step2247 [10]
I believe the correct answer is the second option. Monocots and dicots are two groups of angiosperms. This group of plants are seed bearing plants. Flowers are their reproductive system where the ovules are being enclosed in the ovary. Angiosperms can be found in every habitat from grasslands and forests to deserts and sea margins. Angiospersms are divided to monocots and dicots. Monocot plants are characterized by having one cotyledon while dicots have two. Also, leaf veins of monocots are branched while that of dicots are parallel. The root system of monocots is a fibrous root system while dicots have a taproot system.
3 0
3 years ago
Compare and contrast the body of a crayfish with that of an insect. please help
Papessa [141]

Insects have a distinct set of characteristics which all must have if they are insects. They must have three pairs of legs (even though sometimes they may appear different as larvae, such as caterpillars), a set of mouth parts, and a head, thorax, and abdomen.


3 0
3 years ago
. What makes a TEM useful for examining structures inside cells?
Tasya [4]

Answer:

big pp BIG PP small pp :(

3 0
3 years ago
What would happen to the planets if the Sun no long had gravity?
emmainna [20.7K]

Answer:The plants should float around, we’d no longer be in orbit. With are plants roaming of course the life on Earth would end and it’s likely for plants to collide

Explanation:

3 0
3 years ago
Read 2 more answers
How are global warning and El Nino similar? Is it possible to use effects of El Niño as evidence of potential dangers of global
Angelina_Jolie [31]

El Niño as evidence of potential dangers of global warming to marine ecosystems

Explanation:

El Nino, an abnormal type of weather pattern, causes huge climatic variations globally by bringing floods in one region and drought in another region. These extremely changing patterns in weather can damage human life, agriculture, air quality, natural ecosystems, etc all of which might lead to global warming.  

El Nino effect is a serious potential danger to the marine life. This causes variations in the sea surface temperature, ocean currents, and upwelling patterns. Due to this, many marine organisms either migrate to newer places or do not survive the change.

Due to this, other sea animals depended on them also are depleted of their food source. El Nino also impacts the structure of coral reefs causing coral bleaching which in turn affects the marine life.

8 0
3 years ago
Other questions:
  • Which is the best definition of directional selection
    11·2 answers
  • What causes the formation of graded beds of sediment?​
    10·1 answer
  • In class, your professor shows you the skulls of three mammals. In one, the eye would be fully enclosed by bone. In the second,
    7·1 answer
  • Each degree on the Kelvin scale equals how many degrees on the Celsius scale?
    14·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • A new species of aquatic chordate is discovered that closely resembles an ancient form. It has the following characteristics: ex
    14·1 answer
  • What triggers the development of a tornado?
    15·1 answer
  • Where is the diaphragm located? between the ribs inside the lungs below the lungs above the ribs
    5·2 answers
  • How does the environmental change affect the survival of species ?
    13·2 answers
  • Which type of tissue is strong in one direction, but can rupture if lots of force is applied to the opposite direction of the fi
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!