1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MariettaO [177]
3 years ago
8

When does nondisjunction occur which affects inheritance?

Biology
1 answer:
Rasek [7]3 years ago
3 0
I think the correct answer from the choices listed above is the first option. Nondisjunction occur during meiosis which affects inheritance.  Nondisjunction<span> during </span>meiosis<span> produces eggs or sperm cells that don't have the normal number of chromosomes. Hope this answers the question.</span>
You might be interested in
Transgenic organisms can be scientifically or commercially useful only if __________
Troyanec [42]
Transgenic organisms are those that have had their genomes altered by external means. These organisms are found in applications of genetic engineering, but they are only useful if the inserted gene is expressed in the organism.

An example of a transgenic organism may be a rat with the gene for hemoglobin from a rabbit. This rat is only useful if it indeed does produce rabbit hemoglobin in its blood due to the inserted gene.
8 0
3 years ago
Name and describe Wegener’s Hypothesis
diamong [38]

If you are talking about Alfred Wegener, then his Hypothesis was Continental Drift, a Theory that suggested that all the continents were once one large supercontinent, named Pangaea, But drifted apart from each other over a long period of time.

7 0
3 years ago
The postpartum nurse teaches a mother how to give a bath to the newborn infant and observes the mother performing the procedure.
mariarad [96]
Asking if everything they are doing is okay.
8 0
3 years ago
Why are some sources of sugar better than others?
goldenfox [79]
Because sugar in fruits is good for you but artificial sugar isn’t healthy for you
6 0
3 years ago
Organelles in prokaryotic cells include the
andre [41]

Answer: <u><em> actually (d) none of the above</em></u>

5 0
2 years ago
Other questions:
  • Weather balloons are often used to make measurements in which spear
    11·1 answer
  • Please answer quickly I am on a quiz!!!
    7·2 answers
  • Two methods of active wiretapping are “between lines transmission” and “____.”
    6·1 answer
  • Imagine you are cold, and you hold your hands near a fire. What is the evidence that an
    5·1 answer
  • Translation is divided into three phases: initiation, elongation, and termination. In this tutorial you will gain an understandi
    11·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • When DNA is duplicated during mitosis, _____.
    13·1 answer
  • All of the following refer to mitosis, except repair of damaged cells. production of genetically identical daughter cells. forma
    15·1 answer
  • Defined forestry and its important in nepal?​
    7·2 answers
  • Is it true that the human<br> body can make its own<br> chemicals? Cite evidence<br> from the text
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!