<span>adenine (A), cytosine (C), guanine (G) and thymine (T)
I think
</span>
Answer choices please. If there are any.
Answer:
Explanation:
During mitosis, the chromosomes are distributed equally in the resulting chromosome. The chromosome number was doubled in the S phase of the interphase and the cell is ready for mitosis. The chromosomes are more condensed and twisted in prophase. It is also double in length. During the metaphase, the chromosomes are arranged in the metaphase plate. The microtubules from the centriole attach to the centromere of each chromosome and pull them towards the pole.
Thus each chromatid pulls apart and migrates towards the poles. The nuclear membrane and nucleus disappear during mitosis. At the end of telophase, the daughter cells contain an equal number of chromatids as in the parent cell.
Sometimes the microtubules of centrioles do not function properly and fail to pull the chromosomes equally to the cells. Thus one of the daughter cells contains more chromosomes and another fewer chromosomes. This occurs in anaphase. This results in the non-disjunction of chromosomes.
Sometimes centromere splits transversely instead of longitudinal division. This results in the formation of 2 daughter chromosomes of unequal length. This is called the isochromosomes.
The number of chromosomes distributed in the daughter cells results in a normal cell or any genetic disorder. The main function of mitosis to produce daughter cells having an equal number of chromosomes present in the parent cell.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
