1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Troyanec [42]
2 years ago
13

A student made a model of an onion skin cell she viewed using a microscope. The scale is 1:500.The students cell model has a len

gth of 15cm. How many centimeters is the real cells length?
Biology
2 answers:
Mars2501 [29]2 years ago
8 0

Answer:

Length of the real cells = 7500 cm

Explanation:

A scale model is a physical representation of an object that has the same aspects as that of the object.

A scale model can be used in fields like engineering, film making,  salesmanship, etc

Length of the student's cell model = 15 cm

The scale is 1:500

So,

Length of the student's cell model / Length of the real cells  = 1:500

15 / Length of the real cells  = 1:500

Length of the real cells  = 15 × 500 = 7500 cm

Tanya [424]2 years ago
7 0

Answer:

7500 cm

Explanation:

we in the same grade problem i am on this test

You might be interested in
Male serial killers are more likely to target ________ as victims
DochEvi [55]
I believe it's women.
6 0
3 years ago
Describe protons location charge mass
Damm [24]

Answer:

Protons are found in the nucleus of the atom. This is a tiny, dense region at the center of the atom. Protons have a positive electrical charge of one (+1) and a mass of 1 atomic mass unit (amu), which is about 1.67×10−27 kilograms.6  

Explanation:

8 0
2 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
2 years ago
True or false there are no archaea that hurt humans as far as we know
ololo11 [35]

Answer:false

Explanation:idk

7 0
3 years ago
Read 2 more answers
If an organism did not respond to changing environmental circumstances by regulating gene expression, what is the most likely oc
Licemer1 [7]
B cells would be unable to reproduce 
8 0
2 years ago
Read 2 more answers
Other questions:
  • Bond formed by the sharing of electrons between atoms
    6·2 answers
  • Below is a food chain from an ecosystem.
    7·1 answer
  • Which blood test is performed to measure the level of glucose after the patient has not eaten for at least 12 hours?
    10·1 answer
  • What does the biodiversity on Earth indicate about its organisms?
    11·1 answer
  • After teaching a group of nursing students about diuretics, the instructor determines that the teaching was successful when the
    13·1 answer
  • Which is a structure that directs the cell's activities? nucleus Golgi apparatus ribosome mitochondrion
    11·2 answers
  • Successful resolution of the integrity versus despair stage of adulthood should result in ___________.
    13·1 answer
  • Hi pls help i need to answer question based on the video Bill Nye science guy magnetism.
    11·1 answer
  • This is a short question if anyone would be able to help me please i really need the help!!!!
    8·1 answer
  • Ozone depletion can have negative
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!