1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slava [35]
3 years ago
7

If you were stranded on the ocean in a raft, what would happen if you kept drinking ocean water?

Biology
1 answer:
pav-90 [236]3 years ago
6 0
Maybe it's the concentration of water in your blood would increase (c)
You might be interested in
How did the Earth get these different layers? Did the Earth always have very separate, distinct layers? Describe what happened.
Orlov [11]
Answer: The different layers are a result of lighter parts (such as the continental crust) settling at the surface level and heavier parts (such as iron and nickel in the core) settling in the middle. The layers separate by density, otherwise known as compositional layering. The earth did not always have these layers, as it had to undergo cooling to form some of them (like the continental crust).
7 0
2 years ago
The eyes and nose of the crocodile are set on top of it's head to allow it so to see and breathe while keeping most of it's body
azamat

Answer:

The most fitting answer would be B.Adaptations to fit a location

Explanation:

Hope this helps! If this is incorrect, I am truly sorry.

3 0
2 years ago
What important function is happening in the S phase?
daser333 [38]

Answer:

The answer is D. Synthesizing DNA.

Explanation:

The synthesis (S) phase of the cell cycle is of critical importance to precisely replicating the genomic information encoded in the nucleus of the cell.

The major work of the S phase of the cell cycle is replicating the entire complement of DNA. To do this, the cell activates pre-replication complexes to make replication origins. These are simply areas of the DNA where replication will begin.

6 0
3 years ago
Read 2 more answers
What is most noticeable structural difference between rna and dna?
fredd [130]
Structurally, DNA and RNA are nearly identical. However, there are three fundamental differences that account for the very different functions of the two molecules. RNA has a ribose sugar instead of deoxyribose sugar like DNA.
4 0
3 years ago
The connection between the mother and the embryo that provides the embryo with oxygen and nutrients and waste disposal is the __
maxonik [38]
D.) Placenta (Through the umbilical cord)
7 0
3 years ago
Read 2 more answers
Other questions:
  • Explain what might happen to the fox and the hawk populations if a disease dramatically reduced the mouse population.
    15·2 answers
  • Why is 4 the correct answer to number eighteen ? Explain why and please answer this !!
    10·1 answer
  • Select the correct answer.
    14·1 answer
  • The further down you dig in the earth, the more organic material you will find. true or false
    10·2 answers
  • Plz help me with this
    6·2 answers
  • Which of the following releases energy?
    8·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Is the nitrogen cycle the most important cycle?
    13·2 answers
  • Entre los siguientes métodos de separación de mezclas, Jorge debe seleccionar el adecuado para separar sal de una mezcla de sal
    12·1 answer
  • The process of __________ generates the oxygen that we breathe and the food that we eat. view available hint(s)for part a photos
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!