1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ad libitum [116K]
3 years ago
13

The spring garden smelled like

Biology
2 answers:
disa [49]3 years ago
8 0

Answer:flowers???

Explanation:

Alexandra [31]3 years ago
3 0

Answer:

the spring garden smelled like fresh grass and flowers . I love dancing in the dandylions they make me happy the smell in the air is so fresh it makes my nose clear oh the beautiful day and the smell of the garden combined it  together it the best ever !!

Explanation:

Angie <3 have a wonderful day and remember you are perfect!!!

You might be interested in
What is a sex-linked disorder?
Ugo [173]

Answer:

Sex linked is a trait in which a gene is located on a sex chromosome. In humans, the term generally refers to traits that are influenced by genes on the X chromosome. This is because the X chromosome is large and contains many more genes than the smaller Y chromosome.

Ex: hemophilia

hope this helps

have a good day :)

Explanation:

6 0
2 years ago
Anton van Leeuwenhoek is a scientist who saw cells soon after Hooke did. He made use of a microscope containing improved lenses
Lisa [10]

D:  The cell is the basic unit of structure and organization in organisms.  Explanation: cause I got the question right.

5 0
3 years ago
Read 2 more answers
Select the correct answer.
blondinia [14]

Answer:

c

Explanation:

troposhere bc tropical

8 0
3 years ago
Read 2 more answers
Why is it important to know if the bacteria has a capsule or not?
Advocard [28]
If the bacteria has a capsule, it's more likely to be able to spread or cause a disease. The capsule greatens the chance, as its function is to protect the bacteria, as well as to keep it thriving and alive.
6 0
3 years ago
The 5 carbon sugar in dna is called
Kisachek [45]

Answer:

Ribose and Deoxyribose.

Explanation:

They are both important components of nucleotides, and are found in RNA and DNA.

Hope I helped!

7 0
3 years ago
Read 2 more answers
Other questions:
  • Which STD can affect a person for life because there is no cure
    12·1 answer
  • Please helppp taking it now
    7·1 answer
  • Hot springs are heated geothermally by underlying __________.
    8·2 answers
  • consider The response of a plant cell in a hypotonic solution as seen here. imagine a human red blood cell being placed in the s
    9·1 answer
  • "In the __________ stage of mitosis, the daughter chromosomes of the cell reach the poles, after which the cell passes into the
    7·2 answers
  • Hypothesize how many pennies you believe a floating boat made out of a piece of aluminum foil about the size of your palm could
    11·1 answer
  • Which feature must a community have in order to use wind energy?
    8·1 answer
  • What is a gene? on edge
    13·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • HELP ASAP NOW!
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!