1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
boyakko [2]
3 years ago
9

1)Which region of the world is turmeric native to?​

Biology
1 answer:
borishaifa [10]3 years ago
6 0
South Asia; Turmeric a perennial rhizomatous herb belonging to family Zingiberaceae, originated in India and now widely cultivated in tropical as well as subtropical regions around the globe.
You might be interested in
Explain what was the “Society of Orders” and what distinguished each social group
a_sh-v [17]
DescriptionThe term social order can be used in two senses: In the first sense, it refers to a particular system of social structures and institutions
7 0
3 years ago
Blood plasma is filtered in the __________.
ziro4ka [17]

The Kidneys.

The plasma passes through the kidney where it is filtered, a special filtration unit called "glomeruli" and then excreted as a low molecular weighted product into the urine. The purpose of our urine is to secrete waste products from the body. So you can see how the glomerular filtration mechanism of the kidneys plays a major role in the function of our bodies. The primary function of our kidneys is to filter out all the "bad stuff" in lamest terms.


-Current Medical Student (College Level)

4 0
3 years ago
Planets are classified in yhe domain _____<br>A. archaea<br>B. bacteria <br>C. eukarya​
Gelneren [198K]

Archaea means ancient, bacteria are, well, minuscule organisms that live everywhere, and eukarya are organisms with cells that have a nucleus as well as membrane-bound organelles... my best guess if it is planets you mean, then the answer would be archaea, if it is plants, like flowers or such, then it is eukarya.

I hope this helps!

3 0
3 years ago
Read 2 more answers
What is bacteria of decay?
IrinaVladis [17]
1. The separation of a substance into simpler substances or basic elements. 2. The process of decaying or rotting. Decomposition of dead organic matter is brought about by the activity of certain bacteria and fungi feeding on it.
6 0
4 years ago
A male deer (stag) has long and heavy antlers while the female (doe) does not, Explain the purpose of this genetic variation and
Liono4ka [1.6K]

Antlers are generally only found on male deer in other species of deer. Females with higher-than-normal testosterone levels, on the other hand, can grow antlers.

<h3>Why Do Deer Grow Antlers?</h3>

Antlers are grown by male deer to lure female deer for mating. Females will be shown a display as the antlers are developing during mating season, with each male attempting to become the most dominating.

Deer utilize their antlers to protect themselves from predators and other deer. When deer attack each other, their antlers might lock together, forcing the deer to starve to death.

For more information regarding antlers, visit:

brainly.com/question/17295060

#SPJ1

8 0
2 years ago
Other questions:
  • Describe the main characteristics of plants
    14·1 answer
  • How is a plateau different from a fault-block mountain?
    11·2 answers
  • As the human population grows, what happens to our natural-resource requirements?
    14·2 answers
  • Junior biomedical researchers have long assumed that their hirings and promotions depend significantly on the amount of their pu
    10·1 answer
  • Which of the following is true about the Sun? The Sun is the only star in the Milky Way galaxy. The Sun is one of many stars in
    9·2 answers
  • N ________ a single sperm cell from the man is injected using a microscopic needle, directly into each harvested egg from the wo
    9·1 answer
  • Which state of matter does this model represent?<br> Solid<br> Liquid<br> Gas<br> Plasma
    13·1 answer
  • Please help, thank u. ​
    5·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Children's steady growth, brain maturation, and intellectual advances make middle childhood a time for more _____.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!