Answer:
because with 2 creatures there will be lots of babies with different faces
but with 1 creature it will be cloning
Explanation:
Answer:
<h2>
The organelles are mitochondria and chloroplasts.</h2>
Explanation:
<em>The mitochondria and chloroplasts play a major role in energy conversion that helps to synthezise gene expression products. They were essential to the evolution of present day eukaryotes. These specialized structures are enclosed by double membranes, and they are believed to have originated back when all living thing on Earth were single-celled organisms. The proposed origin of mithocondria and chloroplasts is known as the endosymbiotic hypothesis.</em>
<em>The mithocondria is considered the powerhouses of the cell, it enables eukaryotes to make more efficient use of food sources than their prokaryotic counterparts. Within the eukaryotic cells, mithocondria works like batteries, because they convert energy from one form to another.</em>
<em>The eukaryotic cells may contain several other types of organelles, such as the endoplasmic reticulum, the golgi apparatus and lysosomes. </em>
This particular area of genetics can be quite complex. So basically in DNA their is adenine, cytosine, guanine, thymine. So, then there is another step to this: Adenine links with Thymine (A is to T), and Cytosine pairs up with Guanine (C is to G). This is known as base pairing. However, when translating DNA to RNA their is a catch, there is no thymine in RNA. Instead there is Uracil. SO in RNA it would be like so: A is to U and C is to G. So when transcribing DNA to mRNA it would be like this. I will give an example: DNA: TGA GTC AAT GGC. However with RNA it would be like this, using the same example I just showed you: ACU CAG UUA CCG. Do you see I it now? Basically when transcribing to RNA you use the opposite of all of the original copy except use Uracil instead of Thmine.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
