Answer:
Chloroplast
its function is to create chemical energy using light energy
Explanation:
Photosynthesis occurs in chloroplasts which can be compared to mitochondria because they both produce energy for the organism. The Chloroplast contains within it a pigment, chlorophyll which captures the sun's energy and turns into energy which is used to create other parts of photosynthesis. Chloroplasts capture light energy from the sun to produce the free energy stored in ATP and NADPH through a process called photosynthesis. Chloroplasts are one of the many organelles found in the body, and are generally considered to have originated as endosymbiotic cyanobacteria. In this aspect, they are similar to mitochondria but are found only in plants and protist.
The answer is: insert the gene responsible for larger sized kernels into the genome of the corn with smaller sized kernels and a high yield.<span>
The techniques of genetic engineering are used to introduce hybrid genes for some desired substance or trait into the genome of other organisms. Here, the desired trait is larger sized kernels. So, the gene responsible for this trait will be inserted into the genome of the corn </span><span>with smaller sized kernels and a high yield.
It should be taken into consideration why two other choices are not correct:
1. there are no genes for less or more of something in the genome.
2. genes are part of a genome, so the genome for a trait cannot be inserted into a gene of an organism.</span>
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
I would say C
Explanation:
Based on what I can understand it is asking about how cells age and disease. Something like that.
Oxidents result in aging and creating free radicals. Hydrogen peroxide forms in cells to break down old organelles.
