1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Korvikt [17]
3 years ago
12

Describe how populations of organisms are affected within a community.

Biology
1 answer:
vredina [299]3 years ago
8 0
Climate , temperature , and other organisms
You might be interested in
A man with blood type B and a woman with blood type O produce an offspring.
iren [92.7K]
Go to biology.arizona.edu They have a ton of stuff on blood types. I don’t know if this will help because I’m not in biology yet but I’ve been there and it helped a lot with some stuff. Hopefully that didn’t sound to vague. Have a wonderful day.
3 0
4 years ago
Which statement is the best distinction between birds and other animals? help plz
yarga [219]

Answer:

Bird's have feathers

Explanation:

3 0
3 years ago
What is a possible effect of an error during transcription apex?
MAVERICK [17]
A nonfunctioning protein will be produced
4 0
3 years ago
Read 2 more answers
The proton is a subatomic particle found in the blank of the atom
Anna11 [10]

The proton is a subatomic particle found in the center of the atom.

In the physical sciences, subatomic particles are particles much smaller than atoms. There are two types of subatomic particles: elementary particles, which according to current theories are not made of other particles; and composite particles. Particle physics and nuclear physics study these particles and how they interact.

4 0
3 years ago
A small bag of colored salts plays in a beaker of warm water after a few minutes of water change color you explain how tissues o
worty [1.4K]

Explanation:

Inside the air sacs, oxygen moves across paper-thin walls to tiny blood vessels called capillaries and into your blood. A protein called haemoglobin in the red blood cells then carries the oxygen around your body.

8 0
3 years ago
Other questions:
  • Which of the following reactions is used to radioactively label DNA?
    7·2 answers
  • What is the range of this set of test scores? <br><br> {76, 82, 54, 100, 100, 82, 100, 93, 100, 93}
    9·2 answers
  • Biologists link the various species of the bowerbird to a common ancestor with what kind of evidence
    6·1 answer
  • compare the sex cells produced by mieosis to the parent cell. Why is the difference between the sex cells and parent cell import
    15·1 answer
  • If the Earth were closer to the Sun, the intense heat might evaporate the oceans and create an atmosphere similar to the atmosph
    12·1 answer
  • Please help! whoever answers this first and explains why the answer they chose is right I will mark brainliest!!
    12·2 answers
  • I went on a school trip and saw mr tumble in the bushes with mr bloom. What should I do??
    11·1 answer
  • I will give 20 points so pls help
    12·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • what would happen if the cell membrane was made out of a water-soluble molecule instead of the water-hating lipid.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!