1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lelu [443]
2 years ago
8

MY LAST TRY! WILL GIVE BRAINLIEST!!!! BLESS YOUR GRADES!!!!! EASY I JUST CANNOT DECIDE!!!!

Biology
1 answer:
Akimi4 [234]2 years ago
6 0

The greenhouse effect is the trapping of heat under the atmosphere, which is a natural effect caused by greenhouse gases. However, when greenhouse gas concentrations are too high, they trap too much heat and increase the temperature on Earth, causing the enhanced greenhouse effect.

B i think

You might be interested in
The nurse is caring for a client who underwent intestinal surgery 3 days ago and notices brownish pus with a fecal odor draining
Y_Kistochka [10]
Colonization of aerobic coliform and Bacteroides
5 0
2 years ago
What term describes a substance that has a positive and negative region in a molecule
Gekata [30.6K]

Zwitterion

Zwitterion also known as dipolar ion refers to a substance that has at least one positive and one negative electrical charge at different locations and the net charge of the entire molecule is zero. Examples of zwitterions are amino acids.






6 0
3 years ago
Inbreeding depression
zalisa [80]

Answer: a) rarely occurs in highly connected metapopulations

8 0
3 years ago
The movement of tectonic plates in two locations is described below:
makkiz [27]
Volcanic eruptions may occur in both locations, as the movement can cause the tectonic plates to allow magma through.
7 0
3 years ago
Read 2 more answers
Explain why DNA must be replicated.<br><br><br> I need this ASAP please, ty.
blondinia [14]

Answer:

DNA, found within the nucleus, must be replicated in order to ensure that each new cell receives the correct number of chromosomes.

4 0
3 years ago
Other questions:
  • Name the color of light that is least effective in photosynthesis.
    11·1 answer
  • Jason is blindfolded and cannot verbally identify objects in his left hand, which suggest that he has had a dyslexic episode a l
    12·1 answer
  • What biological molecule contains a large amount of the element nitrogen? A) Carbohydrates B) Lipids C) Proteins D) Starches
    15·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Benign is to inactivate as malignant is to _____. a) shrinking b) active c) dormant d) cancerous
    13·1 answer
  • What is the main difference between a cladogram and a phylogenetic tree?
    13·1 answer
  • What are the three effects of melting sea ice in the polar regions?
    15·2 answers
  • Which is a true statement about conifers? Conifers are flowering plants.Conifers have covered seeds.Conifers' needles lose water
    9·2 answers
  • True / Fasle
    7·1 answer
  • Un recipiente contiene 12 litros de alcohol 18 litros
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!