1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sindrei [870]
3 years ago
12

The smallest functional found within a cell are called

Biology
1 answer:
never [62]3 years ago
3 0

In general, the term organelle is used for the small structures within a cell.

You might be interested in
Help quickly please ill mark brainliest!
Zigmanuir [339]

Answer:

1. homo

2.hetero

3.homo

Explanation:

4 0
2 years ago
Which of these fields is used to classify organisms A. taxonomy B. botany C. genetics D. anthropology.
allsm [11]
Correct answwer is A
7 0
3 years ago
Three nucleotide bases in mRNA, that specifies (codes for) a particular amino acid is called a(n)
zimovet [89]

Answer:

The answer is a codon. A codon is in a mRNA while an anti-codon is in a tRNA.

7 0
3 years ago
Describe the unique appearance of diatoms. what chemical compound composes their outer covering, and what is this shell called?
Natasha2012 [34]
Diatom Cells are enclosed in a cell wall made up of silica or hydrated silicon dioxide namely frustule. The frustule has small walls where nutrients enter, enabling it to perform photosynthesis the same way plants do.
6 0
2 years ago
I Organisms can be dassified based on homology, which is shared characteristics inherited from a common ancestor. In the past, h
olga55 [171]

Answer:

DNA Bases

Explanation:

  • It can't be cellular organelles, division of the nuclear chromosomes, and types of proteins needed for cellular functions, so the answer is DNA bases.
5 0
2 years ago
Other questions:
  • 2. What is the weight of the same book on Mars where the force of gravity is 3.7 N/kg?
    6·1 answer
  • Scientists have been experimenting with gene therapy which often involves the use of bacteria or viruses to deliver new or modif
    14·1 answer
  • Which of the following statements about cellular metabolism is false? Cellular metabolism
    6·1 answer
  • A/an __________ is a swelling of clotted blood trapped in the tissues.
    14·1 answer
  • ______ connected to the left side of the heart, carry blood full of oxygen to the rest of the body.
    8·2 answers
  • Reactants capable of interacting to form products in a chemical reaction must first overcome a thermodynamic barrier known as th
    6·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Which behavior is a response that is determined by heredity?
    12·2 answers
  • Why why why why whywhy
    7·2 answers
  • How is nominal scale type related to diversity?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!