1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nignag [31]
3 years ago
5

How could large seeds help a peanut plant to survive?

Biology
1 answer:
kompoz [17]3 years ago
7 0

Answer:

the chlorophyll and photosynthesis combine to help it grow well

Explanation:

You might be interested in
What age will people start muturing?
Elena-2011 [213]
I dont know #im just a biggener
4 0
3 years ago
The ____________ (size/color) of crystals formed depends on the speed of evaporation.
serg [7]

The right answer is the size.

Crystallization is the operation that consists, of a solution (solvent + solute) or a molten solid, to form a crystallized solid. The solute crystallizes in general in a predefined geometrical form (cubic, face-centered cubic, etc.), including or not solvent molecules (eg pure NA2SO4 or [Na2SO4, 10H2O]). The form or chemical formula of the crystals may depend on the crystallization temperature.

There are two ways of crystallization: The dry way and the wet way (in solution)

In crystallization in solution: the solute is initially in the liquid phase in a solvent. It is crystallized (solidification ordered according to a regular structure) within the solution either by solvent evaporation, or by cooling the solution, or both.

3 0
3 years ago
Read 2 more answers
The gas exchange during cellular respiration involves _____ moving into cells and ____ moving out of cells. The gas exchange dur
ludmilkaskok [199]

The gas exchange during cellular respiration involves oxygen moving into cells and carbon dioxide moving out of cells.

During gas change oxygen actions from the lungs to the bloodstream. on an equal time, carbon dioxide passes from the blood to the lungs. This happens within the lungs among the alveoli and a network of tiny blood vessels known as capillaries, which might be located in the walls of the alveoli.

Three strategies are critical for the switch of oxygen from the out of doors air to the blood flowing through the lungs: airflow, diffusion, and perfusion. ventilation is the manner through which air moves in and out of the lungs.

The lungs and respiratory system permit us to respire. they create oxygen into our bodies (called a concept, or inhalation) and send carbon dioxide out (referred to as expiration, or exhalation). This alternate of oxygen and carbon dioxide is referred to as respiratory.

Learn more about the gas exchange here brainly.com/question/15423560

#SPJ4

6 0
2 years ago
Read 2 more answers
Why does the headless horseman carry his head under his arm geometry worksheet?
Serggg [28]

Based on the question above, the best answer would be:

 

That the headless horseman had to hold his head in his arms is because he “wanted to see what’s ahead.”

 

Or a simple geometric equation of SOH CAH TOA would help solve the angle degree.

3 0
3 years ago
I need some help with this fill in the blanks, picture is above ^ Thanks.
artcher [175]

Answer:

haploid diploid half sex reduction

Explanation:

4 0
3 years ago
Other questions:
  • A 45 yr old female presents with abdominal guarding and ridgidity. the upright x ray is attached. what does "a" indicate virgini
    7·1 answer
  • Similarity between dominant and recessive
    6·2 answers
  • Which is an example of why the process of photosynthesis is important to life on Earth?
    13·2 answers
  • mutation that increases the ability to store moisture in a dry environment is harmful beneficial or neutral
    8·1 answer
  • What is the size of the buccinator muscle on average?
    12·1 answer
  • A biologist conducted an experiment to determine the rate at which DNA mutations occur. The biologist was careful to record the
    15·1 answer
  • All fungi are multi-celled plants. True False
    7·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What do humans need to travel in space that robots do not need?
    5·1 answer
  • If a truck has a mass of 4,250Kg and has a velocity of 20m/s, and a car has a mass of 2,350Kg and a velocity of 24m/s, what is t
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!