Living things require specific organic molecules in order to survive. The picture above represents some specific examples of foods that are mainly composed of one of these necessary organic molecules. The organic molecules found in these types of food are
B)	proteins.
        
                    
             
        
        
        
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
 
        
             
        
        
        
1.its single celled
2.it grows in asia
3.they are long
i hope this helps! please mark as brainliest
        
             
        
        
        
Answer:
The lectin pathway or lectin complement pathway is a type of cascade reaction in the complement system, similar in structure to the classical complement pathway, in that, after activation, it proceeds through the action of C4 and C2 to produce activated complement proteins further down the cascade.
 
        
             
        
        
        
most are formed when a plant or animal dies in a watery environment and is buried in mud and silt.