1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksi-84 [34.3K]
3 years ago
14

Match each kind of drug to a relationship it has with society and culture

Biology
1 answer:
creativ13 [48]3 years ago
6 0
1. Cigarettes
2. Beer
3. Antacids
4. Cocaine
You might be interested in
Living things require specific organic molecules in order to survive. The picture above represents some specific examples of foo
Helga [31]
Living things require specific organic molecules in order to survive. The picture above represents some specific examples of foods that are mainly composed of one of these necessary organic molecules. The organic molecules found in these types of food are

B) proteins.
4 0
3 years ago
Read 2 more answers
Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque
Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0
3 years ago
MARK YOU THE BRAINLIEST!<br> What make a Weeping Willow a eukaryotic cells give three reason why ?
ZanzabumX [31]
1.its single celled
2.it grows in asia
3.they are long

i hope this helps! please mark as brainliest
3 0
2 years ago
What is lectin pathway​
Alex

Answer:

The lectin pathway or lectin complement pathway is a type of cascade reaction in the complement system, similar in structure to the classical complement pathway, in that, after activation, it proceeds through the action of C4 and C2 to produce activated complement proteins further down the cascade.

4 0
3 years ago
How are fossil fuels formed
Luba_88 [7]

most are formed when a plant or animal dies in a watery environment and is buried in mud and silt.

6 0
3 years ago
Read 2 more answers
Other questions:
  • Suppose scientists decided to harvest the mineral nodules on the sea floor. Identify two environmental problems that might occur
    6·2 answers
  • Which vitamin is required for synthesizing heme, a portion of hemoglobin found in blood?
    5·1 answer
  • Metabolic pathways in which cells harvest energy from food molecule in the absence of oxygen is called____
    8·2 answers
  • DNA libraries are useful for identifying and isolating eukaryotic DNA fragments of interest in research. Select the ways in whic
    8·1 answer
  • Where do prokaryotes carry out most cellular processes
    6·1 answer
  • Which of these changes in today's world is a product of advances in biology?
    12·1 answer
  • Chordates are distinguished by four traits: pharyngeal gill slits, muscular tail, notochord, and dorsal nerve cord. what is the
    12·1 answer
  • What happens when boiled liver is added with hydrogen peroxide?
    6·1 answer
  • True or False a Carnivore can never be the first animal in a food chain
    8·1 answer
  • A forest was cleared for the building of a resort, but before construction began, secondary succession set in. Which of these de
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!