1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
timurjin [86]
3 years ago
14

48.Which is a significant environmental cost of burning fossil fuels that is not incurred with the use of the other energy resou

rces?
A. global climate change, which is caused by the transfer of carbon to the atmosphere
B. a disruption of the water cycle, which is caused by the heating of water at power plants
C. radioactive pollutants, which may be accidentally released at power plants
D. localized warming, which is caused by the release of heat into the atmosphere
Biology
1 answer:
maksim [4K]3 years ago
4 0

Answer:

A

Explanation:

big brain

;3

You might be interested in
A certain type of flower has two alleles for color (blue, purple), and two alleles for stem height (tall, short). A tall blue fl
larisa86 [58]

Answer:

Mendel's law of independent assortment

Explanation:

Gregor Mendel is a really important figure in genetics, his work on pea plants provided us with many of the fundamentals of genetics that we still have today!

Mendel proposed 3 laws:

1. The law of dominance - this law states that where there are two different alleles (heterozygous) the organism will always express the dominant trait over the recessive trait

2. The law of segregation - this law states that offspring will inherit one allele from each parent, because allele pairs separate in the process of meiosis, such that each gamete contains 1 allele of each trait. When the zygote is formed, it contains an allele from each parent.

3. The law of independent assortment - this law states that traits are independent from one another at the time of gamete formation. The genes are segregated separately from one another, as the presence of one does not impact the presence of another.

This example shows that all combinations of the height and color allele are possible, and therefore nicely demonstrates the law of independent assortment

6 0
3 years ago
Sunflowers have specialized cells that enable the sunflower to track the
Molodets [167]
B. i searched it up
7 0
3 years ago
The distance time graph for four objects is shown below:
Damm [24]

Answer:

Object A

Explanation:

5 0
3 years ago
Read 2 more answers
Carbohydrates, lipids, and protein are types of carbon compounds that are broken down to produce..
devlian [24]
They make up everything needed to create DNA, although im not very sure, i think the answer your looking for is DNA.
8 0
3 years ago
What process is typical of cancer
zepelin [54]

The cell divides and grows in the organ of origin, causing a localized tumor. Cancer cells then spread to adjacent tissues or regional lymph node drainage areas, and then advance to distant organs or structures, creating metastatic tumors.
4 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What would happen if you wouldn't do experiments in science
    15·1 answer
  • Humans are warm-blooded. They are able to maintain a constant body temperature despite changing environmental temperatures. Whic
    12·1 answer
  • Which of the following functions is performed by a protein
    8·1 answer
  • Scientists discovered that new molten materials from inside the eath create new​
    12·2 answers
  • I still dont get the stages of Mitosis. Please give me a descripition for each one
    10·2 answers
  • *<br> Organisms that feed on decaying organisms are called decomposers<br> True<br> O False
    14·1 answer
  • A student claims that the monarch population increases and decreases in a cycle, similar to the pattern of predator-prey populat
    11·1 answer
  • Uncontrolled cell growth would most likely be attributed to what
    13·1 answer
  • How does change in each independent variable affect the dependent variable?​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!