1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anton [14]
3 years ago
15

Plant organelles that contain chlorophyll for photosynthesis

Biology
2 answers:
kondaur [170]3 years ago
6 0
That would be the chloroplasts. keep in mind that chloroplasts have their own dna,which also indicates that they were once independent organisms that were engulfed by another bigger prokaryote (endosymbiosis). you will probably need to know that later on, so i hope that helps u in the future :)
astraxan [27]3 years ago
3 0
A green oval-shaped organelle in only plant cell that contains chloraphy for all proces of photosynthesis
You might be interested in
How to minimize flood​
Luda [366]

Answer:

some of the ways are...

Explanation:

  • establishing strong dam
  • avoiding construction around water resources
  • properly utilizing and storing rain water for future use
  • flood cannot be stopped totally as it is the effect of nature but its effects can be minimized by using our scientific knowledge and methods
3 0
3 years ago
Read 2 more answers
As you are exposed to high amounts of CO over a period of time your available hemoglobin becomes unable to bind to O2 because it
sattari [20]

Answer:

high enough quantities of CO would cause Cell respiration to stop and eventually cause the organism to die

3 0
3 years ago
Explain why a hydrogen atom can become either an ion or a part of molecule?
NikAS [45]

<span>If it loses that 1 electron (0 electrons, 1 proton, 1 neutron) it become an ion that is positively charge because it has more protons than electrons. [Ignore the neutrons] </span>

<span>If it gains an electron (2 electrons, 1 proton, 1 neutron) it becomes an ion that is negatively charge because it has more electrons than protons </span>

<span>A molecule - when 2 or more "different" elements combine or when 2 or more of the "same" elements combine </span>

<span>1 proton 1 electron <----- that is considered to be neutral </span>

<span>3 protons, 3 electrons <----- neutral </span>

<span>5 protons 5 electrons <----- neutral </span>

<span>6 protons, 5 electrons <-- positive ion [more protons than electrons] </span>

<span>5 protons, 8 electrons <--- negative ion [more electrons than protons] </span>
8 0
3 years ago
Relationship between temperature and the rate of photosynthesis
AURORKA [14]

Answer:

The light independent reactions of photosynthesis are dependent on temperature. They are reactions catalysed by enzymes. As the enzymes approach their optimum temperatures the overall rate increases.

6 0
3 years ago
Do cactus leaves have air spaces? ​
Gnom [1K]

Answer:

As the spies of a cactus are modified leaves, they have ar spaces.

Explanation:

However, leaves of cactus are not like every other leaf. These leaves are in the form of spines to save the amount of water that the cactus needs.

Most of the amount of water, cactus s saving in its root. Also, the stem of a cactus is used for making food, and this is also the way of saving the water.

5 0
3 years ago
Other questions:
  • Witch organism possess valuable fashion items?
    10·1 answer
  • What is the definition of lackadaisical?
    15·1 answer
  • Many organisms could potentially provide new medicines for human use, making which of the following crucial?
    11·1 answer
  • What are the products in the equation for cellular respiration?
    12·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • If an animal is in the family ursidae, what also must be true about that animal?
    5·1 answer
  • A muscle that swings two long bones in an arc toward each other is a ______
    7·2 answers
  • Assume you stain Bacillus by applying malachite green with heat and then counterstaining with safranin. Through the microscope,
    10·1 answer
  • What makes African Literature unique?​
    6·1 answer
  • How many tumor cells would it take to kill a full and healthy grown person?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!