1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anastaziya [24]
3 years ago
6

Where does Decomposers get their energy from?

Biology
1 answer:
valentina_108 [34]3 years ago
8 0
By breaking down dead organisms and animal waste. Which releases nutrients back into the environment
You might be interested in
What ingredients in macconkey agar supplies carbon?
IRISSAK [1]
Peptones and beef extract

MacConkey agar is a selective and differential culture medium for bacteria designed for isolation of Gram negative and usually enteric  bacilli, based on their ability to ferment lactose. It contains bile salts, crystal violet, neutral red dye. There are many variations of MacConkey agar depending on the need. This medium was developed by Alfred Theodore MacConkey. This agar can distinguish gram negative bacterias that can ferment. This is known as the indicator medium.
7 0
3 years ago
Mendel investigated stem length, or height, in pea plants. What if he had investigated human height instead? Why would his resul
Whitepunk [10]

The phenomena of polygenic inheritance would have become a grievous fault to his investigation, if he had investigated human height instead of stem length of pea plants.

Explanation:

The polygenic or polygenetic inheritance is the inheritance where the trait of a particular allele is passed on to the next generation with many genes involved in order to show the genotype and phenotype of the allele present on the same chromosome.

The stem length or plant height depends on the single factor of allelic gene inheritance and expression in phenotype, making it simpler to trace down the division of meiosis and control the experiment as needed. Considering human height for a chance, may lead to uncontrolled condition of having next generation study as well as the time required to be long. Other factor was that the height is dependent not only on the height gene expression but is controlled by nutrition and environmental factors too.

4 0
4 years ago
Cheetah have evolved a much higher lung capacity,why
Stella [2.4K]

Cheetah need a large lung capacity because they consume a lot of oxygen while sprinting.

8 0
3 years ago
Read 2 more answers
What are local problems that the endangerment of honeybees causes?
Contact [7]

Answer:

Pollination

Explanation: If you have ever seen bee movie, you know that pollen is the most essential ingredient to flowers, which is transported and spread by bee's. if there were no more bees, there would be no way to pollinate the flowers, causing them to wither and die. Fortunately, there are other pollinators, but bees are one of the most important.

3 0
3 years ago
Whats the concept map
ololo11 [35]
A concept map or conceptual diagram is a diagram that depicts suggested relationships between concepts
7 0
3 years ago
Other questions:
  • What would you be most likely to measure by immersing an object in water and seeing how much the water level rises
    12·1 answer
  • Name two places smooth muscles are found
    15·2 answers
  • Is the understanding that knowledge in a particular area can be uncertain
    5·2 answers
  • What kind of virus, which started spreading last weekend, affected more than 200,000 victims in about 150 countries worldwide?
    11·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • 3
    9·1 answer
  • What is the purpose of controlling the environment wine testing a hypothesis ?
    10·1 answer
  • What type of cat would be the best control to compare with Calix?
    10·2 answers
  • NAME all the steps of Respiration. What is Produced in Each Step? What are the
    9·1 answer
  • Quincy is conducting an experiment with limestone rock. He works with five rocks and begins by recording the mass of each rock.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!