1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zarrin [17]
3 years ago
13

What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT

Biology
1 answer:
juin [17]3 years ago
3 0

How does DNA differ from RNA in terms of structure? 2. How does DNA differ from RNA in terms of function? 3. Who is credited for establishing the structure of DNA? 4. Explain what is meant by semi-conservative DNA replication. 5. Given the following DNA strand: TACGTATGCCGTATGGGCATT What is the complementary DNA sequence? hope it helps :D

You might be interested in
how many ways could homologous pairs of two chromosomes line up along the equatorial plate such that genetic differences arise i
disa [49]

There are TWO different ways by which homologous pairs of two chromosomes line up along the equatorial plate. In meiosis, these differences will be evidenced by the genetic makeup of daughter cells.

During metaphase, homo-logous chromosomes are lined up at the middle of the cell (i.e., the equator plate).

Subsequently, during anaphase, homo-logous chromosomes are separated, thereby daughter cells will receive only one homo-logous chromosome of the chromosome pair.

Meiosis is a type of cell division characterized by the independent assortment of chromosomes, which is due to the random assortment of homo-logous chromosomes at the metaphase plate.

This independent assortment offers unique compositions of alleles in daughter (meiotic) cells.

Learn more in:

brainly.com/question/9624015?referrer=searchResults

4 0
3 years ago
On average, what percentage of our daily calories comes from sweets, sodas and fruit drinks, alcoholic beverages, and salty snac
Sauron [17]
On average I'd say 70% of our calories come from these things.
8 0
3 years ago
Which is an example of the way matter cycles through he bodies of living things ?
Shkiper50 [21]

Answer;

A. People eating salmon

Explanation;

-All of the materials an organism takes in are returned to the ecosystem, while the organism lives or after it dies.The movement of matter through the living and nonliving parts of an ecosystem is a continuous process, a cycle.

-Matter in an ecosystem may change form, but it never leaves the ecosystem, so the matter is said to cycle through the ecosystem.

6 0
4 years ago
Read 2 more answers
if a man with type ab blood marries a woman heterozygous for type A what is the probability that their child would be type B???
Anna11 [10]

Answer:

1/4.

Explanation:

Via a punett square, the only possible combinations are AA, AB, AO and BO. Since BO is the only way the child has type B, the chances are 1 in 4.

8 0
3 years ago
Explain the statement: “Cells are the basic units of structure and function in living things.”
77julia77 [94]
Cells form the parts of an organism and carry out all of the organism's functions.
4 0
3 years ago
Read 2 more answers
Other questions:
  • Why do parasitic flatworm not need a digestive system
    7·1 answer
  • What is free energy?
    6·2 answers
  • What gas is changed by some bacteria into a form that plants can use?
    13·1 answer
  • During diffusion, do molecules move from areas of low concentration to high concentration, or high concentration to low concentr
    6·1 answer
  • Which of the following can change scientific knowledge?
    15·2 answers
  • When water forms from hydrogen and oxygen water is the
    12·1 answer
  • Why is water capable of forming a hydrogen bond
    7·1 answer
  • Which is the first step to occur during the process of replication?
    5·1 answer
  • Which two atoms form an ionic bond?
    9·2 answers
  • Is menstural cycle also called periods?​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!