1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zarrin [17]
3 years ago
13

What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT

Biology
1 answer:
juin [17]3 years ago
3 0

How does DNA differ from RNA in terms of structure? 2. How does DNA differ from RNA in terms of function? 3. Who is credited for establishing the structure of DNA? 4. Explain what is meant by semi-conservative DNA replication. 5. Given the following DNA strand: TACGTATGCCGTATGGGCATT What is the complementary DNA sequence? hope it helps :D

You might be interested in
A studenr wants to germinate seeds over the winter
Likurg_2 [28]

Answer:

D and B

Explanation:

We know that seeds need optimal amounts of water, oxygen, temperature, and light to germinate. Therefore the student would need to provide warmth because its winter and water because that would satisfy the need for moisture. Hope this helps!

Source: https://extension.psu.edu/seed-and-seedling-biology

4 0
3 years ago
Read 2 more answers
A group of mollusks That became more abundant and important parts of reefs
ICE Princess25 [194]
Bivalves are abundant and important parts of reefs.
8 0
3 years ago
Read 2 more answers
Which part of the eye changes shape in order to regulate how much light enters?
egoroff_w [7]
The pupil controls how much light enters the eye
6 0
3 years ago
Please select the word from the list that best fits the definition
lesya [120]

The answer is A. Gravity

6 0
3 years ago
shawna is very knowledgeable about cars. she subscribes to several different automobile magazines, has interviewed people who wo
umka2103 [35]
Based on the description, it's safe to assume that her information would be Reliable

Not only she had a deep knowledge about cars, she also done various researches and studied about car directly from the expert

hope this helps
3 0
4 years ago
Other questions:
  • Thus is the question I'm NOT Sure of the awnser any help?
    13·1 answer
  • 5. What is the difference between multivalent and trivalent?
    13·1 answer
  • What is the difference between a cell, a tissue, an organ, and a system in an animals body
    5·1 answer
  • Color blindness occurs when an individual is unable or has diminished ability to see certain colors. Red‑green color blindness i
    5·1 answer
  • WILL GIVE BRAINLIEST!!RATE!!VOTE!!!HELP!!!!!!!!!!!!!!!!!
    14·2 answers
  • Which statement is true about DNA ? a.Both of the original DNA strands act as templates during replication. b.It is a single-str
    9·1 answer
  • It is best to formulate a hypothesis and collect data BEFORE publishing a theory.
    6·2 answers
  • 2. While playing in a park, a child was stung by a wasp. Some elders se
    15·1 answer
  • Cual es la reaccion de los tubulos de malpighi en agua salinas
    14·1 answer
  • What do organsims and organelles have in common? (other than being living things)​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!