1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zarrin [17]
3 years ago
13

What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT

Biology
1 answer:
juin [17]3 years ago
3 0

How does DNA differ from RNA in terms of structure? 2. How does DNA differ from RNA in terms of function? 3. Who is credited for establishing the structure of DNA? 4. Explain what is meant by semi-conservative DNA replication. 5. Given the following DNA strand: TACGTATGCCGTATGGGCATT What is the complementary DNA sequence? hope it helps :D

You might be interested in
Eukaryotic organisms that are neither fungi, plants, nor animals are members of which kingdom?
natulia [17]
Eukaryotic organisms that are neither fungi, plants, nor animals are members of the Protista <span>kingdom. </span>
6 0
3 years ago
Please help
Iteru [2.4K]

Answer:

biotic is like your cat, the bugs and every living tiny bacteria, but don't get me started on viruses.

abiotic, your food processor, your wall, your hair cells are not technically part of you since you can live with-out em.

Explanation:

yes

5 0
3 years ago
4. The size of a bryophyte is limited because it has no system for transporting water high
Serga [27]

Answer:

True.

Explanation:

Bryophytes lack the conventional vascular tissues which usually contain the substance lignin. Without vascular tissues, these plants have no means of transporting water and/or nutrients from their lower organs to the higher organs which explains their limited height.

Hope this helps! Brainliest? Anyways have a great day!! :))

3 0
3 years ago
Please help!!
LuckyWell [14K]
Huge mountains, like the Himalayas are created when the continental crusts collide and fold into each other. This causes the earth to slowly start rising into mountain peaks, which cause the mountains to appear.
4 0
3 years ago
Does the bone marrow of all bones produce immune cells?.
Ann [662]

Answer:

Yes

Bone marrow is the spongy tissue inside bones that produces blood cells. Bone marrow produces red blood cells, platelets, and white blood cells. Lymphocytes are produced in the marrow, and play an important part in the body's immune system.

Explanation:

Please mark me brainliest

5 0
2 years ago
Other questions:
  • Normally, there is no glucose in urine. glucose may appear in the urine as a result of uncontrolled _______.
    8·1 answer
  • Discuss how temperature and amount of precipitation can affect the type of plants and animals found in the deciduous biome. guys
    12·1 answer
  • Explain a scenario in which secondary succession would occur.
    8·1 answer
  • Alternative energy sources like solar and wind power _______.
    7·2 answers
  • What are the basic types of neurons in the spinal cord?
    9·1 answer
  • I need help in science I don't understand this.
    8·1 answer
  • Which of the following will most likely increase the amount of erosion that occurs on the banks of a river?
    6·1 answer
  • That’s the question pls someone answers it
    11·2 answers
  • The Earth has _________ large convections currents. *
    6·1 answer
  • What does the term “carbon neutral” means? How does it relate to math?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!