All categories

3 years ago

Why are negative feedback loops used to control body homeostasis? (Short answer)

Biology

1 answer:

liberstina [14]3 years ago

8 0

Answer:

Homeostasis is defined as the state of body in which body maintains several chemical and physical changes inside the body affected by external factors.

Negative feedback loop includes a sensor, stimulus, control center, and effector which is used to control homeostasis.

A negative feedback loop is a reaction that reduce an excessive response and maintain the functions within the normal range. for example: if temperature and blood glucose level increases in the body, negative feedback loops control both the variables and maintain homeostasis.

Hence, negative feedback loops used to control body homeostasis.

You might be interested in

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

netineya [11]

Answer:

The complementary base pair is ATG TTT GTG ATA TGG CGC ATT TAC TAA

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC AAA CAC TAT ACC GCG TAA ATG ATT

ATG TTT GTG ATA TGG CGC ATT TAC TAA

5 0

2 years ago

Lawrence Kohlberg built on the theories of _____ in his description of the stages of moral development. A. Carol Gilligan B. Jea

Ymorist [56]

Answer:

Lawrence Kohlberg build on the theories of Jean Piaget in his description of the stages of moral development.

Explanation:

The earlier work of Jean Piaget on cognitive development of children was expanded by Lawrence Kohlberg which he described in 6 stages.

1.Stage 1 : Obedience and punishment orientation

This is focused on children to obey rules and avoid from punishment.

2.Stage 2: Orientation through instruments

Individual should have to be in their best interest

3.Stage 3 : Good boy , nice girl orientation

The children will approve others and acts to avoid disapproval.Emphasis is placed on good and nice behavior.

4.Stage 4:Law and order orientation

The child will accept the rules of the society as rules are same for everyone.

5.Stage 5: Social contract orientation-

The world holds different opinions,right,and values and each will accept it mutually.

6. Stage 6: Universal ethical principal orientation-

It is based on abstract reasoning where ethical principles are used.

7 0

3 years ago

Suppose a restriction enzyme recognizes the six-base sequence aagctt ttcgaa in a double strand of dna . Between which two nucleo

AfilCa [17]

Answer:

Explanation:

1. A restriction enzyme, restriction endonuclease, an enzyme that cleaves DNA into small fragments at or near specific recognition sites (different restriction enzyme has different restriction site) within molecules known as restriction sites.

2. Restriction enzymes are found in archaea and bacteria.

3 And in bacteria and archaea they provide a defence mechanism against invading viruses.

4. Each restriction enzyme cut at the specific site, because each restriction enzyme have specific recognition site.

3 0

3 years ago

Which characteristic do all prokaryotes and eukaryotes share?

Vsevolod [243]

cells all feature a nucleus, and their organelles are enclosed inside

4 0

3 years ago

Read 2 more answers

Which organisms appeared on earth first

STatiana [176]

The organisms which appeared on earth first was bacteria.

<u>Explanation:</u>

The first-ever living organism on Earth was a bacteria known as cyanobacteria. It is believed by scientists that it first formed around 3 billion years ago.

When the Earth was first formed, it was inhospitable for a long time until 3.8 billion years ago approximately, the core cooled down and the level of oxygen had risen. This, along with photosynthesis resulted in the formation of Cyanobacteria.

These organisms were capable of carrying out the process of photosynthesis by which they prepared their food. These were known as common ancestors. All the living organisms thereafter are known to be their descendants.

6 0

3 years ago

Read 2 more answers