1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lisabon 2012 [21]
3 years ago
10

Bacteria is a first line of defense for our immune system. true or false a. true b. false

Biology
1 answer:
hichkok12 [17]3 years ago
6 0

Answer:

The answer is b. false.

Explanation:

You might be interested in
2.3.4 Quiz: DNA Technology
Paladinen [302]

Answer:

I think its the choice a

Explanation:

3 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Without heat from the Sun, the water cycle would A) reverse. B) not work. Eliminate C) slow down. D) not be affected.
allsm [11]
"not work" would be your answer
6 0
3 years ago
Read 2 more answers
Which kind of organism is a heterotroph?
just olya [345]
Autotrophs are organism that is a Heterotroph. 
7 0
3 years ago
Which basin in texas is rich in petroleum
brilliants [131]

Answer:

Permian Basin, also called West Texas Basin, large sedimentary basin in western Texas and southeastern New Mexico, U.S., noted for its rich petroleum, natural gas, and potassium deposits. Owing to its economic importance, it is one of the most well-studied geologic regions of the world

Explanation:

Have good day !

3 0
3 years ago
Other questions:
  • the agent of mechanical weathering in which rock is worn away by the action of other rock particles is called
    10·1 answer
  • What is the function of the atria
    10·2 answers
  • Explain the process of digestion of food in small intestine of man​
    14·1 answer
  • Which of the following terms refers to bloodstains that are not visible to the naked eye?
    11·2 answers
  • Living things get the energy they need from carbohydrates such as glucose. What is the relationship between carbohydrates and AT
    9·1 answer
  • Descriptive data is also called _________ data.
    13·1 answer
  • There is a new brand of water on the market that has been proven to relieve headaches. It is selling like crazy! When the Food a
    12·1 answer
  • The discovery of cells is most directly linked to the
    7·1 answer
  • Galileo Galilei discovered that Earth moved around the sun, which was the opposite of what most people believed at the time. Wha
    7·2 answers
  • Bacteria convert nitrogen gas from the atmosphere into nitrates which are
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!