1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnoma [55]
3 years ago
14

What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT

Biology
2 answers:
Kazeer [188]3 years ago
8 0
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Alina [70]3 years ago
4 0

Answer:

AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA

Explanation:

As you may already know, DNA and RNA are formed by complementary nitrogenous bases.

DNA is formed by the bases Adenine (A), Thymine (T), Cytosine (C) and Guanine (G), while RNA is formed by Adenine (A), cytosine (T), Cytosine (C) and Guanine (G ). These nitrogenous bases are complementary to each other. This complementarity makes the bases of a DNA strand sleep hydrogen bonds with another DNA strand, joined together. It also allows mRNA to be formed in the transcription process, using the complementarity of bases as a template to create the mRNA strand. In this regard, Adenine is complementary to Timine (in DNA) and Uracil (in RNA), while cytosine is complementary to Guanine.

For this reason, we can conclude that if a DNA strand exhibits the base sequence "TACGCTCCATATCGCTAATCGCCGGATCAGATT", due to the complementarity, the mRNA will present the base sequence "AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA".

You might be interested in
Which trophies level contains more energy: strophic level of herbivores or a trophies level of carnivores? Why?
Elden [556K]
Herbivores. The eat directly from the producers. 10% of the producer's energy goes to herbivores, while only 10% of the 10% energy the herbivores had goes to carnivores.
6 0
3 years ago
List 3 positive things that humans use algae for:
Svetradugi [14.3K]

Here's a few I got off google

#1: Algae Is Efficient to Create BioFuel.

#2: Algae Can Use Land That Would Otherwise Go to Waste.

#3: Algae Can Be Used for Animal Feed.

#4: Algae Can Function As An Energy Source.

#5: Algae Can Be Used To Create Vegetable Oil.

#6: Algae is a Great Human Food Supplement.

Use which ever ones you want

3 0
3 years ago
A scientist claims that volcanic eruptions caused dinosaurs to become extinct at this location. Decide whether you agree or disa
larisa86 [58]

Answer:

Dinosaurs are the extinct organisms that belong to the class reptilia. Dinosaurs are the most advanced and bulkier reptiles at the history time and they were overspecialized in their environment.

The dinosaurs extinct rapidly due to the change in the external conditions and the volcanic eruptions that occur at the dinosaurs time. The recent searcher claims that asteroid impact and massive volcanic eruption leads to the dinosaur extinction. The fossil evidence and the presence of the specific basalt and other chemicals are found in the volcanoes and in the asteroid.  

8 0
2 years ago
Identify three human three humen solution for limitting global warming
antoniya [11.8K]
Reduce carbon dioxide emissions, pollution, and deforestation
reuse materials rather than throwing them away and needing to create more
recycle materials like metals, paper, and plastics
replace non-biodegradable materials with biodegradable

4 0
3 years ago
Explain how the basic structure of an atom has led to the diversity of compounds making up living and nonliving things
kobusy [5.1K]

Atom refers to a tiny particle, which is the basic building block of all the substances and whose properties determine the characteristics of an element made up of only of those atoms.  

All the living and nonliving matter in this world are made up of atoms and elements. Everything in the universe is matter, and matter comprises elements. Some of the elements are important to living things.  

Elements are formed by atoms, and atoms comprise protons, electrons, and neutrons. The number of protons in an element's atom signifies the identity of the element.  


5 0
3 years ago
Other questions:
  • Define hematopoietic tissue. where can you find this type of tissue
    5·1 answer
  • Gene flow or migration is the transfer of alleles or genes from one population to another. Select the combination of facts that
    15·2 answers
  • What is the purpose of a dichotomous key of the sort you might find in a field guide?
    12·2 answers
  • Recording from single neurons in the brain has shown that neurons responding to specific types of stimuli are often clustered in
    9·1 answer
  • A group of animal behaviorists has discovered several new species of insects in the Amazon jungle. They collect the new species
    12·1 answer
  • When excess glucose is present, it is used to form glycogen through a process called?
    6·1 answer
  • Which electronegative element/compound do chemosynthetic bacteria use drive the electron transport chain
    14·1 answer
  • What is the difference between a hypothesis and a theory?
    7·2 answers
  • Hello please help i’ll give brainliest
    10·1 answer
  • Which of the following is NOT a monomer?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!