1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnoma [55]
3 years ago
14

What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT

Biology
2 answers:
Kazeer [188]3 years ago
8 0
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Alina [70]3 years ago
4 0

Answer:

AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA

Explanation:

As you may already know, DNA and RNA are formed by complementary nitrogenous bases.

DNA is formed by the bases Adenine (A), Thymine (T), Cytosine (C) and Guanine (G), while RNA is formed by Adenine (A), cytosine (T), Cytosine (C) and Guanine (G ). These nitrogenous bases are complementary to each other. This complementarity makes the bases of a DNA strand sleep hydrogen bonds with another DNA strand, joined together. It also allows mRNA to be formed in the transcription process, using the complementarity of bases as a template to create the mRNA strand. In this regard, Adenine is complementary to Timine (in DNA) and Uracil (in RNA), while cytosine is complementary to Guanine.

For this reason, we can conclude that if a DNA strand exhibits the base sequence "TACGCTCCATATCGCTAATCGCCGGATCAGATT", due to the complementarity, the mRNA will present the base sequence "AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA".

You might be interested in
Animals who eat the same food are categorized in the same niche. <br> a. True<br> b. False
Lelu [443]
The correct answer is letter A. The statement above is true that when animals eat the same type of food they are categorized in the same niche. Niches are ecological communities or ecosystems where specific organisms thrive and fit. Their evolutionary processes are also a result of these different niches found within the environment.
8 0
3 years ago
Read 2 more answers
Why do Primary succession happen
Alja [10]

Answer:

Explanation: Primary succession occurs when new land is formed or bare rock is exposed, providing a habitat that can be colonized for the first time. For example, primary succession may take place following the eruption of volcanoes, such as those on the Big Island of Hawaii. As lava flows into the ocean, new rock is formed.

4 0
3 years ago
Which of these is not a natural earth cycle?<br> rock<br> water<br> carbon<br> oil
Andrei [34K]

Answer:

The answer is oil .

Explanation:

<u>Oil</u> is not a natural Earth cycle.

(Correct me if I am wrong)

4 0
2 years ago
BRAINLIESTTTT ASAP!<br><br> What challenges did the United States face during Reconstruction?
Svet_ta [14]
Outrage from the North because of the black codes that the South set.

I hope this helps!

5 0
3 years ago
Where are the plant stem cells found
ElenaW [278]

Answer:

they are found in the meristem of the plant

4 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is NOT a benefit of breathing through the nose? 1) extraction of heat and moisture from the air leaving t
    8·2 answers
  • What are the functions of arthropod appendages?
    7·1 answer
  • Jordan's grandmother uses the juice from squeezed lemons to remove stains from his shirt. He hypothesizes that the juice is the
    6·1 answer
  • Inhibiting enzymes involved in cell wall synthesis leads to which of the following? A) cell death by osmotic lysisB) a reduction
    7·1 answer
  • Plants take up carbon dioxide from the air and nutrients from the soil. This is an example of interactions between the
    15·1 answer
  • The offspring from asexually reproduced organisms are
    13·1 answer
  • Can someone plz help me on this plz help me I’ll appreciate it
    5·2 answers
  • MtDNA can link subjects that are maternally related.<br><br> True<br> False
    9·1 answer
  • The dart thrower was throwing at the bullseye. what is the best description of this attempt?
    6·1 answer
  • the zonation of flora and fauna along an altitudinal transect similar to that found along latitudinal transects is an expression
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!