1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnoma [55]
3 years ago
14

What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT

Biology
2 answers:
Kazeer [188]3 years ago
8 0
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Alina [70]3 years ago
4 0

Answer:

AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA

Explanation:

As you may already know, DNA and RNA are formed by complementary nitrogenous bases.

DNA is formed by the bases Adenine (A), Thymine (T), Cytosine (C) and Guanine (G), while RNA is formed by Adenine (A), cytosine (T), Cytosine (C) and Guanine (G ). These nitrogenous bases are complementary to each other. This complementarity makes the bases of a DNA strand sleep hydrogen bonds with another DNA strand, joined together. It also allows mRNA to be formed in the transcription process, using the complementarity of bases as a template to create the mRNA strand. In this regard, Adenine is complementary to Timine (in DNA) and Uracil (in RNA), while cytosine is complementary to Guanine.

For this reason, we can conclude that if a DNA strand exhibits the base sequence "TACGCTCCATATCGCTAATCGCCGGATCAGATT", due to the complementarity, the mRNA will present the base sequence "AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA".

You might be interested in
Based on your observations, which way does earth rotate—from east to west, or west to east? Explain your answer.
JulijaS [17]

Based on my observations, the earth rotates from west to east about the axis of rotation. The counter-clockwise rotation of the earth is as viewed from the North Pole star Polaris.

My observations supporting the counter-clockwise rotation of the earth are:

  • The Sun rises in the east and sets in the west.
  • All celestial objects including the stars and the moon rise in the east and set in the west.

The rotation is the result of the strong geomagnetic field of the earth. It is also responsible for the formation of day and night on the planet.

Learn more about the Rotation of the earth:

brainly.com/question/24246687

6 0
10 months ago
Why is the plasma membrane selective?
lakkis [162]
I think it’s So lipid-soluble molecules do not enter or exit the plasma membrane unassisted


Hope this helps so sorry in advance if it’s wrong but hope it helps
3 0
3 years ago
Please help me!!!!!!!!!
kobusy [5.1K]

Answer:

D. Competitive

Explanation:

Animals seem to get aggressive during interaction with other animals.

6 0
3 years ago
What is true of carbon atoms? (2 points)
Rudiy27
By process of elimination you can find the right answer. We know for a fact that carbon is found in all living organisms. That is why we talk about carbon based life forms. So the first statement cannot be true. You can figure out how many Valence electrons an element has by looking at the group number. The group number of carbon is 4 so the 2nd statement cannot be true. We know that carbon does bond with other elements because it is not a noble gas and therefore must be able to form compounds.
This means the answer must be they can form up to four covalent bonds
6 0
3 years ago
The end product of transcription is _____ and the end product of translation is _____.
ANTONII [103]
<h2>Answer:</h2>

The correct answer is option C. And the full statement is:

The end product of transcription is <u>__mRNA___</u> and the end product of translation is _<u>_Proteins_</u>__.

<h3>Explanation:</h3>
  • Translation and the transcription are the two main process of central dogma of life.
  • DNA is the nucleotide sequence for the protein production. In this process DNA is first converted to RNA and then RNA moves to the cytoplasm for the production of proteins in the ribosomes.
  • So the transcription is process in which DNA is converted into mRNA in the cytoplasm.
  • In cytoplasm production of proteins by the mRNA is known as translation.
7 0
3 years ago
Other questions:
  • What energy transformation occurs when a car stereo is turned on?
    13·2 answers
  • HELP BIOLOGY QUESTION:
    14·1 answer
  • In biological systems, _____ of _______ molecules, such as glucose, yield the energy necessary for cellular processes to occur.
    13·1 answer
  • Which of the following statements best describes a conversion factor?
    11·1 answer
  • Is cell wall an animal cell plant cell or both
    7·1 answer
  • A cell is a complex system. Like most systems, a cell contains a boundary that separates things that are inside the system from
    12·1 answer
  • Lol Answer This. Good Luck
    7·2 answers
  • Cystic fibrosis is inherited with the autosomal recessive allele c. Individuals with the autosomal dominant allele C do not have
    5·1 answer
  • Why is cell division important for one-celled organisms and multi-celled organisms
    13·1 answer
  • if you were to watch an individual neurotransmitter molecule just after it was released what would happen to it
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!