All categories

3 years ago

What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT

Biology

2 answers:

Kazeer [188]3 years ago

8 0

AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.

Alina [70]3 years ago

4 0

Answer:

AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA

Explanation:

As you may already know, DNA and RNA are formed by complementary nitrogenous bases.

DNA is formed by the bases Adenine (A), Thymine (T), Cytosine (C) and Guanine (G), while RNA is formed by Adenine (A), cytosine (T), Cytosine (C) and Guanine (G ). These nitrogenous bases are complementary to each other. This complementarity makes the bases of a DNA strand sleep hydrogen bonds with another DNA strand, joined together. It also allows mRNA to be formed in the transcription process, using the complementarity of bases as a template to create the mRNA strand. In this regard, Adenine is complementary to Timine (in DNA) and Uracil (in RNA), while cytosine is complementary to Guanine.

For this reason, we can conclude that if a DNA strand exhibits the base sequence "TACGCTCCATATCGCTAATCGCCGGATCAGATT", due to the complementarity, the mRNA will present the base sequence "AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA".

You might be interested in

A de-shelled egg is placed in tap water. The egg grows in size.

ipn [44]

C I did your test and got 100% I’m a g at this I promise you

6 0

3 years ago

Identify the evolutionary forces that can cause allele frequencies to change from one generation to the next.

Irina-Kira [14]

Allele frequencies to change from one generation to the next.-

B. Mutation; C. Random genetic drift; D. Migration; F. Natural selection

Selection, mutation, migration, and genetic drift are the mechanisms that effect changes in allele frequencies.
When one or more of these forces are acting, the population violates Hardy-Weinberg assumptions, and evolution occurs.

Why do allele frequencies change from one generation to the next?

Random selection: Allele frequencies may fluctuate from one generation to the next when people with particular genotypes outlive those with different genotypes.

No mutation: Allele frequencies may fluctuate from one generation to the next if new alleles are produced via mutation or if alleles mutate at different rates.

What are 5 factors that cause changes in allele frequency?

A population, a collection of interacting individuals of a single species, exhibits a change in allele frequency from one generation to the next due to five main processes.
These include natural selection, gene flow, genetic drift, and mutation.

Learn more about allele frequency

brainly.com/question/7719918

#SPJ4

The complete question is -

Identify the evolutionary forces that can cause allele frequencies to change from one generation to the next. Check all that apply

A. Inbreeding

B. Mutation,

C. random genetic drift

D. migration

E. extinction

F. natural selection

6 0

2 years ago

What kind of bonds hold the phosphate groups together in ATP and ADP? Exxplain please

tigry1 [53]

Answer:

These phosphate groups are linked to one another by two high-energy bonds called phosphoanhydride bonds.

Explanation:

When one phosphate group is removed by breaking a phosphoanhydride bond in a process called hydrolysis, energy is released, and ATP is converted to adenosine diphosphate (ADP).

7 0

3 years ago

According to the Law of Conservation of Matter, if the reactants of photosynthesis have 18 oxygen atoms, how many oxygen atoms w

bogdanovich [222]

Answer:

Explanation:

all the law is saying is that matter cant be created nor destroyed, so if 18 oxygen atoms are used, there will be 18 oxygen atoms in the end, no matter what, doesn't matter what they use it for or what

5 0

2 years ago

Which set of classification terms is shown in order of increasing numbers of organisms per group.

Zigmanuir [339]

species, genus, phylum

3 0

3 years ago