Answer:
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA
Explanation:
As you may already know, DNA and RNA are formed by complementary nitrogenous bases.
DNA is formed by the bases Adenine (A), Thymine (T), Cytosine (C) and Guanine (G), while RNA is formed by Adenine (A), cytosine (T), Cytosine (C) and Guanine (G ). These nitrogenous bases are complementary to each other. This complementarity makes the bases of a DNA strand sleep hydrogen bonds with another DNA strand, joined together. It also allows mRNA to be formed in the transcription process, using the complementarity of bases as a template to create the mRNA strand. In this regard, Adenine is complementary to Timine (in DNA) and Uracil (in RNA), while cytosine is complementary to Guanine.
For this reason, we can conclude that if a DNA strand exhibits the base sequence "TACGCTCCATATCGCTAATCGCCGGATCAGATT", due to the complementarity, the mRNA will present the base sequence "AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA".
