1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnoma [55]
3 years ago
14

What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT

Biology
2 answers:
Kazeer [188]3 years ago
8 0
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Alina [70]3 years ago
4 0

Answer:

AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA

Explanation:

As you may already know, DNA and RNA are formed by complementary nitrogenous bases.

DNA is formed by the bases Adenine (A), Thymine (T), Cytosine (C) and Guanine (G), while RNA is formed by Adenine (A), cytosine (T), Cytosine (C) and Guanine (G ). These nitrogenous bases are complementary to each other. This complementarity makes the bases of a DNA strand sleep hydrogen bonds with another DNA strand, joined together. It also allows mRNA to be formed in the transcription process, using the complementarity of bases as a template to create the mRNA strand. In this regard, Adenine is complementary to Timine (in DNA) and Uracil (in RNA), while cytosine is complementary to Guanine.

For this reason, we can conclude that if a DNA strand exhibits the base sequence "TACGCTCCATATCGCTAATCGCCGGATCAGATT", due to the complementarity, the mRNA will present the base sequence "AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA".

You might be interested in
This is any unwanted substance or toxin that is expelled from organisms. Example: urea, carbon dioxide
denis23 [38]
<h3><u>Answer;</u></h3>

Waste

<u>Waste</u> is any unwanted substance or toxin that is expelled from organisms. Example: urea, carbon dioxide.

<h3><u>Explanation;</u></h3>
  • <em><u>The body must remove waste products from the all the tissues in the body. These waste products are constantly being produced by the body tissues and must therefore be excreted, because if they are not, they will increase in concentration and may interfere with chemical reactions or damage cells.</u></em>
  • <em><u>Waste products include, carbon dioxide and Urea</u></em>. They are excreted through various body system and excretory organs, which includes, kidney that eliminates water, urea and other waste products in the form of urine, lungs which eliminates carbon dioxide from the body, and skin which excretes excess water.

7 0
3 years ago
Read 2 more answers
What is the difference between Gibbs Free Energy and Helmholtz Free Energy, and which is more applicable to biological systems?
timofeeve [1]

Answer:

The Gibbs free energy (G) of a system is a measure of the amount of usable energy (energy that a job can do) in that system. Changing Gibbs free energy during a reaction provides useful information about the energy and spontaneity of the reaction while Helmholtz free energy is a thermodynamic property that can be used to predict whether a process occurs spontaneously at constant volume and temperature.

Explanation:

<u>Gibbs free energy is the most used for biological systems</u> since it allows to relate the enthalpy change of the reactions occurred in the system and determine for example if they occur spontaneously or not, if they produce heat or absorb heat.

On the other hand, Helmholtz energy (also called Helmholtz function, Helmholtz free energy or work function) is an extensive quantity, thermodynamic potential and state function, of a thermodynamic system that measures the work obtainable in a closed system, in constant temperature conditions. . It does not depend on the process suffered, but on the final and initial state of the system

7 0
3 years ago
What process is used by bacteria to divide and reproduce
yulyashka [42]

Bacteria divides and reproduce by the process of binary fission.

6 0
3 years ago
Choose all the answers that apply. Antibodies _____. are highly specific only work against certain antigens are produced by macr
Dahasolnce [82]

Answer: are highly specific only work against certain antigens

are part of the body's adaptive immunity

Antibody, also called as immunoglobulin, are proteins which are produced by the immune system of the organism against the action of the foreign substance, also called as antigen. Antibodies recognizes specific antigens, removes them from the body and provides the body immunity. Antibodies are specifically produced by the specialized white blood cells called as B lymphocytes.

6 0
3 years ago
Read 2 more answers
If a supply-demand curve were applied to basic resources, _____.
maksim [4K]
The correct option is A.
Basic resources are those resources that are very important to a business or an individual, one just have to buy the resources whether they are cheap or expensive. The application of supply demand curve to a basic resource will result in the increase of the price of that resource, because supplier will always be willing to supply more at higher prices.<span />
3 0
3 years ago
Read 2 more answers
Other questions:
  • Dan is an overweight, middle-aged history professor who snores loudly and periodically stops breathing during sleep. dan has a c
    5·1 answer
  • Which of the following adaptations is not used to enable movement in protists? A. Pseudopod B. Spores C. Conjugation D. Flagella
    12·2 answers
  • The doctor advising Mary about her plans for pregnancy repeatedly warns her about the consequences of toxoplasmosis. Why would t
    15·1 answer
  • The process used to convert seawater into freshwater is known as
    10·1 answer
  • What is a sundew plant
    5·2 answers
  • Benda yang dapat memancarkan cahaya
    15·1 answer
  • A ratio of 3:1 in the phenotype of an organism occurs when
    15·1 answer
  • For those who were involved in the earthquake in Haiti was which category of stress?
    13·1 answer
  • What amount of force needs to be applied to a 20 kg bowling ball to give it an acceleration of 5 m/s2? Bubble your answer on you
    11·1 answer
  • Which category of birds can find food on both land and large body of water
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!