1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnoma [55]
3 years ago
14

What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT

Biology
2 answers:
Kazeer [188]3 years ago
8 0
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Alina [70]3 years ago
4 0

Answer:

AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA

Explanation:

As you may already know, DNA and RNA are formed by complementary nitrogenous bases.

DNA is formed by the bases Adenine (A), Thymine (T), Cytosine (C) and Guanine (G), while RNA is formed by Adenine (A), cytosine (T), Cytosine (C) and Guanine (G ). These nitrogenous bases are complementary to each other. This complementarity makes the bases of a DNA strand sleep hydrogen bonds with another DNA strand, joined together. It also allows mRNA to be formed in the transcription process, using the complementarity of bases as a template to create the mRNA strand. In this regard, Adenine is complementary to Timine (in DNA) and Uracil (in RNA), while cytosine is complementary to Guanine.

For this reason, we can conclude that if a DNA strand exhibits the base sequence "TACGCTCCATATCGCTAATCGCCGGATCAGATT", due to the complementarity, the mRNA will present the base sequence "AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA".

You might be interested in
What is the point at which a dna strand is unzipped so that it can form new complementary bases?
gayaneshka [121]
The anwser is double helix

8 0
3 years ago
Read 2 more answers
What is ozone and how does it effect any ecosystem
Basile [38]
Its the first layer of protection in the atmosphere against radiation from the sun and its harmful U.V. rays. 
4 0
3 years ago
Read 2 more answers
Which celestial bodies have one or more moons?
andrew-mc [135]
<span>Mars has two. Earth has one. Mercury and Venus are the only planets without moons. The outer Solar System includes Jupiter, Saturn, Uranus, Neptune and Pluto and the rest of the moons.</span>
6 0
3 years ago
Read 2 more answers
The transmission of genetic material from one generation to the next is necessary for the survival of a species. Which statement
krek1111 [17]
A is the correct answer
5 0
3 years ago
Saturated fats have long straight tails of fatty acids, while unsaturated fats from vegetables have kinks in their tails due to
Ipatiy [6.2K]

Answer:

Saturated fats/ solid fats

Explanation:

Vegetable oils amongst other unsaturated oils are liquids at room temperature while saturated oils are solids or spreadable at room temperature.

Industrially, vegetable oils are hydrogenated; hydrogenation is the process of adding hydrogen to an unsaturated compound to make it saturated. This then makes these hydrogenated vegetable oil, saturated which makes them solids as earlier stated, they are also called cis - fatty acids.

Trans - fatty acids as well are also unsaturated oils which are hydrogenated industrially to give saturated fatty acids which are called artificial tran-fats. They are found in most commonly found in baked and fried goods.

4 0
3 years ago
Other questions:
  • Most animal cell membranes have proteins that pump what ions out of the cell and potassium ions into the cell.
    7·1 answer
  • A fight between a family of lions and family of hyenas over an animal carcass would be best described as competition between
    14·2 answers
  • Two watersheds are separated by a ____________?
    6·2 answers
  • Which of these is a type of nonpoint source pollution that might occur on a farm ?
    9·2 answers
  • Which of the steps in this sequence of events is an example of mitosis at work?
    14·2 answers
  • Are butane and isobutane structural isomers
    13·1 answer
  • Meiosis producer daughter cell​
    5·2 answers
  • Help anyone please lol be serious
    10·1 answer
  • Which supplies your body with energy?<br> A. nutrients<br> B. vitamins<br> C. blood<br> D. water
    5·2 answers
  • What would happen to an ecosystem if an invasive
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!