What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT

Biology

2 answers:

Kazeer [188]3 years ago

8 0

AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.

Alina [70]3 years ago

4 0

Answer:

AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA

Explanation:

As you may already know, DNA and RNA are formed by complementary nitrogenous bases.

DNA is formed by the bases Adenine (A), Thymine (T), Cytosine (C) and Guanine (G), while RNA is formed by Adenine (A), cytosine (T), Cytosine (C) and Guanine (G ). These nitrogenous bases are complementary to each other. This complementarity makes the bases of a DNA strand sleep hydrogen bonds with another DNA strand, joined together. It also allows mRNA to be formed in the transcription process, using the complementarity of bases as a template to create the mRNA strand. In this regard, Adenine is complementary to Timine (in DNA) and Uracil (in RNA), while cytosine is complementary to Guanine.

For this reason, we can conclude that if a DNA strand exhibits the base sequence "TACGCTCCATATCGCTAATCGCCGGATCAGATT", due to the complementarity, the mRNA will present the base sequence "AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA".

You might be interested in

According to the principal of dominance, if a recessive gene for tallness is paired with another recessive gene for tallness, th

AfilCa [17]

According to this principal, if a recessive gene for tallness is paired with another recessive gene for tallness, the organism is categorized as a homozygous recessive in terms of its genotype.

3 0

3 years ago

Read 2 more answers

What is the purpose of a conclusion?

ohaa [14]

It would be d. in your conclusion you want to state if your hypothesis was right or wrong and why.

8 0

3 years ago

Outer boundary of the cell in a Plant cell

Alexandra [31]

Answer:

cell wall

Explanation:

Cell wall is the outermost boundary in plant cell whereas plasma membrane or cell membrane is the outermost boundary in animal cells. In a plant cell, cell membrane is found in the inner side of the cell wall.

5 0

3 years ago

Read 2 more answers

Windy weather during summer season is<br>pleasant, why<br>?

Llana [10]

Answer:

because it cools you off when its too warm and overall gives a sense of calm

5 0

3 years ago

Does an rh negative individual normally contain anti rh antibodies

fiasKO [112]

An Rh negative individual does not contain anti Rh antibodies. Rh- antibodies only develop in cases of pregnancy, miscarriage or a blood transfusion like if you have Rh-negative blood you got AB blood. The Rh-antibodies then work to attack the foreign substance, the RBCs. In the fetus, loss of RBCs means the rise of bilburin and could eventually lead to brain damage and also have low muscle tone.

4 0

3 years ago