1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnoma [55]
3 years ago
14

What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT

Biology
2 answers:
Kazeer [188]3 years ago
8 0
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Alina [70]3 years ago
4 0

Answer:

AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA

Explanation:

As you may already know, DNA and RNA are formed by complementary nitrogenous bases.

DNA is formed by the bases Adenine (A), Thymine (T), Cytosine (C) and Guanine (G), while RNA is formed by Adenine (A), cytosine (T), Cytosine (C) and Guanine (G ). These nitrogenous bases are complementary to each other. This complementarity makes the bases of a DNA strand sleep hydrogen bonds with another DNA strand, joined together. It also allows mRNA to be formed in the transcription process, using the complementarity of bases as a template to create the mRNA strand. In this regard, Adenine is complementary to Timine (in DNA) and Uracil (in RNA), while cytosine is complementary to Guanine.

For this reason, we can conclude that if a DNA strand exhibits the base sequence "TACGCTCCATATCGCTAATCGCCGGATCAGATT", due to the complementarity, the mRNA will present the base sequence "AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA".

You might be interested in
Why is the birth of modern science (c.1500-1700) important to how we understand knowledge and disciplinary divisions today
Mandarinka [93]

The correct answer to this open question is the following.

Although there are no options attached, we can say the following.

The birth of modern science (c.1500-1700) was important to how we understand the knowledge and disciplinary divisions today because the scientific method was established to get proper validation to the things in nature that in the past were attributed only to dive concepts expressed by the Church.

That old fashion way of thinking, validated by the church during the dark ages of Medieval Times, only created fear and fostered ignorance in people.

The advent of modern science changed this thing, basing its theories and answers on proper research that could be proven. That is how the human mind expanded and grew. No more myths and distorted religious beliefs that were so wrong.

6 0
3 years ago
Describe nodes of ranvier and their role in transmitting impulses
Mekhanik [1.2K]

Answer:

Nodes of Ranvier are gaps in the myelin sheath coating on the neural axon. The myelin allows the electrical impulse to move quickly down the axon. The nodes of Ranvier allow for ions to diffuse in and out of the neuron, propagating the electrical signal down the axon.

7 0
3 years ago
Just say which to circle and which to box.
juin [17]

Answer:

box wood, tree and plastic.

circle, cork, sponge

brainliest please?

Explanation:

3 0
4 years ago
EDTA is delivered to the kidneys and removed from the body in urine. how does this process also lead to the removal of heavy met
Zarrin [17]

Answer:

EDTA Is the medication used to bind to metals in order for your body to excrete them in your urine. Chelation therapy is the use of EDTA for this purpose.

Explanation:

3 0
3 years ago
Would you say a leaf cell or a leaf vessel or a leaf tissue or something else?!?
vlada-n [284]

Its more logical to say a leaf tissue because of the presence of several tissues inside it which are performing their designated functions.

<h3><u>Explanation:</u></h3>

If we look at the cross section of a leaf, the leaf tissue looks having several tissues. There are vascular bundles in the midrib that are xylem and phloem. Then there are leaf parenchyma which contains the chloroplasts.

They are palisade parenchyma on upper layer and spongy parenchyma. Then there are leaf epidermis on both upper and lower surfaces of leaf. So because of the presence of different tissues, they are collectively called as leaf tissue.

4 0
3 years ago
Other questions:
  • What would be the primary reason for an emt to change gloves between contact with different patients?
    8·1 answer
  • How do inferences relate to observations?
    8·1 answer
  • SOLVE A wildlife biologist and her team counted 200 individual deer
    7·1 answer
  • The simple question of whether or not viruses are alive, has defied a simple answer because it raises the fundamental issue: Wha
    11·2 answers
  • 1. Consortiums benefit marine science for all of the following EXCEPT?
    12·2 answers
  • What influences the amount of gravity a planet has? (Answer must be in a full sentence)
    14·1 answer
  • Differences in the DNA between two individuals is known as?
    14·1 answer
  • Please help I’m being timed and please no links
    9·2 answers
  • 8. X= 36 x 12 of 18<br>9. X = (25 x 3) = 15<br>10. X = 12 x 14 of 16​
    12·1 answer
  • I need help please ?!!!! Asap thank you (:
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!