1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnoma [55]
3 years ago
14

What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT

Biology
2 answers:
Kazeer [188]3 years ago
8 0
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Alina [70]3 years ago
4 0

Answer:

AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA

Explanation:

As you may already know, DNA and RNA are formed by complementary nitrogenous bases.

DNA is formed by the bases Adenine (A), Thymine (T), Cytosine (C) and Guanine (G), while RNA is formed by Adenine (A), cytosine (T), Cytosine (C) and Guanine (G ). These nitrogenous bases are complementary to each other. This complementarity makes the bases of a DNA strand sleep hydrogen bonds with another DNA strand, joined together. It also allows mRNA to be formed in the transcription process, using the complementarity of bases as a template to create the mRNA strand. In this regard, Adenine is complementary to Timine (in DNA) and Uracil (in RNA), while cytosine is complementary to Guanine.

For this reason, we can conclude that if a DNA strand exhibits the base sequence "TACGCTCCATATCGCTAATCGCCGGATCAGATT", due to the complementarity, the mRNA will present the base sequence "AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA".

You might be interested in
Homologous chromosomes move toward opposite poles of a dividing cell during ______.
Leokris [45]

Answer:

anaphase

Explanation:

5 0
3 years ago
An organic compound formed is the dark reaction of photosynthesis is
blsea [12.9K]

Answer:

B i think

Explanation:

3 0
3 years ago
Read 2 more answers
By which process of cell division can body cells pass on mutations to new body cells?
Liula [17]

Answer:Mutations are irreversible and are passed on to the daughter cells during mitosis. Certain genes are involved in the maintenance of normal cell growth patterns

Explanation:

4 0
3 years ago
Juanita sticks a nail to the end of a bar magnet. She then sticks a second nail to the first, then another to that one, and so o
Andreas93 [3]

Answer – The force of gravity is stronger than the force of magnetism.

 

The attractive force of magnetism is the force that keeps the nails joined to one another and to the end of a bar magnet while the force of gravity is the force acting to pull the nails to the ground. If when Juanita sticks the seventh nail, it falls off the sixth nail, it means that the force of gravity acting on the seventh nail is stronger than the force of magnetism acting on it.

8 0
3 years ago
Read 2 more answers
I WILL GIVE YOU 100 POINTS, BRAINLIEST, FIVE STARS, AND HELP U WITH ANYTHING ELSE U WANT IF U JUST PLEASE WRITE THIS.
Nadya [2.5K]
Name

Date: May 1st

Date completed: May 12th

Hypothesis: I believe the seeds will grow 1-2 feet based on my research

Procedure: I put my seeds in small pots and put on a self I have outside in the sun. They can absorb good sunlight this way

Growth of seeds: all varied but stayed within 3 feet

Type of seeds:
1. Cornflowers

Growth
Day 3: about 2 inches
Day 6: about 5 inches
Day 9: about 12 inches
Day 12: about 22 inches
Day 15: about 34 inches

Interpretations: cornflower- the meaning is wealth, prosperity, fortune and friendship.

I don’t know what was asked in the lab...

Conclusion: my hypothesis was kind of correct. My cornflowers grew to be over 2 feet, but not by much. Some even stayed under, but not by much I say again. This was a fun and educational experience and I learned a lot about this wonderful plant. I hade no idea that it was even a real thing before this project! I learned that different flowers grow at different paces, even if they get the same amount of sunlight and water.
3 0
3 years ago
Read 2 more answers
Other questions:
  • A plasmid vector has a gene for erythromycin resistance (Ery") and a gene for ampicillin resistance (Amp"). The Ery gene is cut
    5·1 answer
  • Polymers are made of individual subunits called _____________________________ 2. Chains of glucose make up _____________________
    10·1 answer
  • What is the main significance of the biogeochemical cycles?
    7·1 answer
  • What 3 factors can affect tissues
    13·1 answer
  • BRAINLIESTTT ASAP!!!!<br><br> Explain what Lunar phases are in specific detail in one paragraph.
    14·1 answer
  • Adaptations are _________.
    7·1 answer
  • How many states of matter are found in water?
    5·2 answers
  • A volcanic eruption covers a wide area of forest with Ash lava and volcanic rock.
    13·1 answer
  • ________ arises when different microbes within a population or community try to acquire the same resource.
    8·1 answer
  • A collection of orbitals around the nucleus, each having its own energy level.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!