1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MAVERICK [17]
4 years ago
12

A planar projection map is most useful for sea navigation. True or False

Geography
2 answers:
Solnce55 [7]4 years ago
8 0

Answer: True. :)

It's always true.

LUCKY_DIMON [66]4 years ago
4 0
True,

I hope this helps
You might be interested in
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Analyze the map below and answer the question that follows.
solmaris [256]

Answer:

D

Explanation:

6 0
3 years ago
Read 2 more answers
1. Geologists who specifically study earthquakes are called ____________. A. seismologists C. vulcanologists B. paleontologists
vagabundo [1.1K]

Answer:

the answer is a

Explanation:

7 0
4 years ago
write a message congratulations to your friend who has won gold medal in interschool Chess championship​
nikdorinn [45]

Answer:

Great Job! I am very proud of you! I hope u do it again! yipee! woo hoo! Yesss!

4 0
4 years ago
Read 2 more answers
What are two countris in north Africa
posledela

Libya, Tunisia, Morocco, and Egypt are a few.

Use Libya and Tunisia for your answer.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Quais foram a consequências da guerra de secessão para o espaço geográfico dos eua?
    5·1 answer
  • Please help!
    6·1 answer
  • Which statement about Lebanon after the end of the civil war is accurate?
    5·1 answer
  • What is the process that changes solid rock into sediments
    9·2 answers
  • Which is the most ethical response if an experiment fails to confirm a hypothesis?
    14·1 answer
  • How does movement within the earth's impact changes on the earth surface?
    5·1 answer
  • What did the Dutch seek in the new world
    12·2 answers
  • The first European power to establish a trading post in India was __________.
    8·1 answer
  • Help! <br> can you tell me which are which pleace.
    12·1 answer
  • You're at 34 degrees north and 118 degrees west. You go north 10.9 degrees and west 80.3 degrees. What's your new location?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!