Answer:
According to Darwin natural selection is a process by which living organisms adapt and change to survive in nature and it's limited resources.
Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
Answer:
when vesicles cluster at the future plane of division
Explanation:
Cytokinesis is the process whereby the cytoplasm of a cell divides into two. This process of cytokinesis occurs after nuclear division i.e. division of the nucleus. However, cytokinesis differs in plant and animal cells.
In plant cells, the separation of the cytoplasm involves the formation of a cell plate. The process begins when a structure called phragmoplasts carry vesicles to the cell plate. In other words, vesicles cluster at the future plane of division (cell plate).
Formula to create heat of fusion (hof) i q=m•/\Hf
to get the amount of heat energy you need to
however much you have gxj/g
find J
Answer:
<u><em>stapes</em></u>
The stapes is the smallest and lightest bone in the human body and is so-called because of its resemblance to a stirrup (Latin: Stapes).
Explanation:
I hope that this answer has helped you to more thoroughly understand your question asked. If you have any further questions, please do not hesitate to ask them below.
Have a great rest of your day/night!