1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
max2010maxim [7]
4 years ago
14

Discuss three environmental factors that lead to mutations in DNA

Biology
1 answer:
BartSMP [9]4 years ago
7 0

Answer: try this i hope its right forgive me if it not

Explanation: Mutations can occur during DNA replication if errors are made and not corrected in time. Mutations can also occur as the result of exposure to environmental factors such as smoking, sunlight and radiation.

You might be interested in
What body system does Osteoporosis affect?
Blizzard [7]
Osteoporosis affects the the skeleton whereby the bones become brittle and fragile as a result of deficiency in vital nutrients such as calcium and vitamin D
6 0
3 years ago
What’s the difference between positive feedback and Negative feedback??!!!!
kotegsom [21]

Answer AND Explanation:

In homeostatic control processes any deviation from the norm sets into motion the appropriate corrective mechanisms, which restore the norm. This rectification or removal of deviation occurs through negative feedback. This contrasts with positive feedback where a deviation from the norm leads to further deviation.

7 0
3 years ago
How can you tell from a food web which organisms will have the greatest biomass?
Zolol [24]

Answer:

<u><em>How can you tell from a food web which organisms will have the greatest biomass?</em></u>

The tropic level contains the greatest biomass in most ecosystems is producers. This occurs because producers get their energy from the sun, the sun is the most available resource, so there are the most at that level.

Explanation:

I hope that this answer has helped you to more thoroughly understand your question asked. If you have any further questions, please do not hesitate to ask them below.

Have a great rest of your day/night!

7 0
3 years ago
Please help quick I'm timed
Sliva [168]
I believe the answer is <span>seismogram</span>
8 0
4 years ago
Sympathetic preganglionic neurons emerge from the __________ portion of the spinal cord.
SCORPION-xisa [38]
There are choices for this question namely:

<span>A. cranial
B. lumbar
C. thoracic
D. sacral
E. lumbar and thoracic
</span>
The correct answer is "lumbar and thoracic". The sympathetic nervous system has its preganglionic neurons at the thoracolumbar region of the spinal cord (T1 to L2 or L3) and will synapse to its corresponding ganglion near the spinal cord called the paravertebral ganglia. This is in contrast to parasympathetic nervous system where its preganglionic neurons are found in the cranial and sacral (hence craniosacral) regions and synapse to its corresponding ganglion near the effector organ.
7 0
4 years ago
Other questions:
  • 11. The term ESTUARY comes from the Latin word AESTUS, which means "tide". How does this meaning relate to the definition of EST
    7·1 answer
  • Divergent faults form when tectonic plates _____. move away from one another stop moving crash into one another slide past each
    8·2 answers
  • NEED HELP
    13·1 answer
  • Is the law of inertia and Newton’s first law mean exactly the same thing
    14·1 answer
  • What do we need nitrogen and phosphorus for
    13·2 answers
  • My last one ⚠️⚠️
    10·1 answer
  • Cell structure and function
    8·1 answer
  • In mammalian eggs, the receptors for sperm are found in the A) fertilization membrane. B) zona pellucida. C) cytosol of the egg.
    11·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • Answer the following question below.<br> You don’t need a answer on why u think that
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!