1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mashcka [7]
3 years ago
8

Как понять последнее предложение?

Biology
1 answer:
Talja [164]3 years ago
8 0

Answer:

tu merde, translate from french

You might be interested in
A newly discovered gene has two aleles a and a scientists hypothesize that the alleles show incomplete dominance
tatiyna
If scientists believe that the newly discovered gene has two alleles A and a and that the alleles show incomplete dominance, the best way to prove this is to look for subjects who are homozygous with respect to the different alleles. The offsprings will all have the genotype of Aa and if indeed, the alleles show incomplete the dominance, the traits of the first generation will not manifest completely but a mixture of two will.
4 0
3 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
What kind of animals like flatworm with long unsegmented body.
zloy xaker [14]

Answer:

Animal phyla

Earthworm

Hope it will help you

7 0
3 years ago
Look at the map above. what type of weather is the northwest having?
MA_775_DIABLO [31]
Cold front


If you don’t know the compass, just go by Never Eat Soggy Waffles

North East South West
4 0
3 years ago
The cell membrane around a cell forms a barrier that protects and regulates the cell. Which best describes those that can pass t
pickupchik [31]
Ok I think its small polar molecules but I could be wrong. 
7 0
3 years ago
Other questions:
  • Some students believe that if they drink a glass of milk before bed and would make them sleep longer what’s the independent vari
    11·1 answer
  • What is needed for an idea to be scientifically reliable?
    5·1 answer
  • Geneticists sometimes use the following test for the nullness of an allele in a diploid organism: If the abnormal phenotype seen
    5·1 answer
  • If two chromosomes of a species are the same length and have similar centromere placements and yet are not homologous, what is d
    14·1 answer
  • Which of the following physical properties of a women are constant from lemon to lemon?
    13·1 answer
  • What are the products of aerobic cellular respiration? Check all that apply.
    13·1 answer
  • Through the process of transformation, bacteria cells can take up plasmids that contain recombinant DNA
    15·1 answer
  • An ecosystem experiences a ten year drought. As a result of the
    15·1 answer
  • The _____ of the brain is more active during visual imagery encoding. inner left temporal lobe lower left frontal lobe upper lef
    12·1 answer
  • Predict what would happen to other organisms in an ecosystem in which all the decomposers went extinct?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!