Answer:
Water has a very high specific heat capacity. This is because energy is needed to break hydrogen bonds. water resists temperature changes, providing a more stable environment within cells and for aquatic organisms.
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
Answer:Meiosis is where a diploid cell gives rise to haploid cells, and fertilization is where two haploid cells (gametes) fuse to form a diploid zygote.
Explanation:Answer to question #2:
(of a cell or nucleus) having a single set of unpaired chromosomes.
Answer:
The chemical composition of the soil, the topography, and the presence of living organisms determines the quality of soil. In general, soil contains 40-45% inorganic matter, 5% organic matter, 25% water, and 25% air.
Explanation:
Answer:
I couldn't find the chart anywhere, but if you have produced pigmy stripe rabbits already, it'll be possible interbreed the rabbits from the stock. I mean pigmy rabbit with pigmy rabbit only. Other type of rabbits are different species.
Explanation:
Pigmy striped rabbits belong to Brachylagus genus, and are different enough from another types of rabbits to be crossed, and obtain fertile progeny.
Physically, pigmy rabbits are much smaller than a mean rabbit (European rabbits or cottontail rabbits), and probably their genitalia don't fit properly.
Apart from this, many other differences exist, although cottontail rabbits are the most similar, genetically speaking
