1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
navik [9.2K]
3 years ago
12

In affected colonies ________________.

Biology
1 answer:
Galina-37 [17]3 years ago
6 0
A, there is no queen bee
You might be interested in
Swimmers itch is an initial symptom of which of the following?A. tularemiaB. schistosomiasisC. Chagas diseaseD. Lyme diseaseE. m
bogdanovich [222]

Answer: B. schistosomiasis

Explanation:

Swimmer's itch is also called as cercarial dermatitis. It appears as a skin rash. It is typically an allergic reaction which is caused by a parasite.

Swimmer's itch is the symptom of Schistosomiasis. It is a disease which is also called as snail fever. It is caused by the parasitic flatworm called as schistosomes. This parasite infects the urinary tract and intestine in humans. Other symptoms include the diarrhea, abdominal pain, bloody stool and blood in the urine.

6 0
3 years ago
I HAVE ALREADY CHOSEN THE T-REX
zavuch27 [327]

1.) The name of my organism is the Tyrannosaurus Rex.

2.) The T-Rex went extinct 65 million years ago when the meteor hit the earth.

3.) We couldn't have done anything about this.

4.) The T-Rex lived mainly in North America and Aisa, in forests with plant-eating dinosaurs.

5.) The T-Rex was tall and stood on 2 legs. the other legs were usually up off the ground for eating its prey. I had really sharp teeth for eating meat.

7 0
3 years ago
Read 2 more answers
PLEASE HURRY! Will give brainliest!!
makvit [3.9K]
Option b is the answe
7 0
2 years ago
In terms of environmental economics, the only factions that disagree with each other are environmentalists and economists. True
MatroZZZ [7]

The correct answer is FALSE.

It is false that the only factions which disagree with each other is economists and environmentalists.

Economists are referred to as practitioners which are found in the social science and their work is to discipline economics.

A person can develop, study and apply some concepts and theories from economic.

Environmentalists are termed as supporters who supports the movement of the environment.

There is a ethical movement of the movement or political which works to protect and improve quality of environment which is natural.

Environmentalist believes in environmentalism philosophy.

3 0
3 years ago
Read 2 more answers
Nucleic acids (DNA and RNA) are made of phosphorus, hydrogen, carbon, oxygen, and nitrogen.
S_A_V [24]

Answer:

A. True

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • People with lactose intolerance should still eat dairy products.
    14·1 answer
  • HELP!!! What substance moves across the cell membrane during osmosis?
    10·2 answers
  • Help please help!!!!
    5·1 answer
  • Match the essential public health services with the examples that follow:
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • In coronary angiography, a clinically significant blockage in a major coronary artery is considered to be an obstruction of at l
    15·1 answer
  • Will reward 100 pts and brainly if you answer this question correct How do cells determine what size to grow to before dividing?
    6·2 answers
  • Cells are:
    8·2 answers
  • Which enzyme breaks down cannabis?
    9·1 answer
  • Which result is consistent with the intestine actively transporting glucose from mucosal to serosal side, with a critical need f
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!