Answer: b. The use of protein as an energy source is greater for endurance atheletes than those who body build or lift weights.
Explanation:
Proteins are the biomolecules. They are composed of polymers of amino acids. It is required by the body to repair tissues and build muscles, bones, and necessary component of skin, and cartilage.
The body of athletes require more protein than body builder or weight lifters. This is because during athletic practices like running, swimming and others the muscular mass should be strong enough to conduct long continous practice. The muscle mass is build up by proteins. The muscles may experience lack of oxygen during regular practice and may become weak. Thus require more protein so that the strength may remain maintained.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer: It must be based on scientific observations that can be repeated in a controlled setting.
Explanation:
A scientific claim is the claim which includes statement(s) which is verified by the observations obtain after multiple experimental trials or procedures in a controlled experiment. A scientific claim can only be considered as wrong when a valid argument or prove satisfies the fact why it is wrong.
Answer:
Alternate form of gene
Explanation:
An allele is a variant form of a gene. Some genes have a variety of different forms, which are located at the same position, or genetic locus, on a chromosome. Humans are called diploid organisms because they have two alleles at each genetic locus, with one allele inherited from each parent.
The process wouldn't work,and the DNA would goes backward.
