1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tamaranim1 [39]
3 years ago
7

Ivan is interested in becoming an engineer in the field of improving communication technology. He hasn't yet decided if he wants

to focus more on the hardware or software side of the technology.
What would Ivan be studying if he focused on software?

A. the soft parts of the technology, such as the rubber coating around the wires
B. the antenna within the technology that sends and receives the data
C. the computer that runs the physical parts of the technology
D. the programming that makes the physical parts of the technology run​
Biology
1 answer:
charle [14.2K]3 years ago
5 0

Answer:

van is interested in becoming an engineer in the field of improving communication technology. He hasn't yet decided if he wants to focus more on the hardware or software side of the technology. What would Ivan be studying if he focused on software? ... the antenna within the technology that sends and receives the data.

Explanation:

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Why does light change direction when shined through water?
Molodets [167]
The slowing down of the ray of light also causes the light to change direction
8 0
3 years ago
Which forms asks for information about medical conditions such as allergies?
creativ13 [48]
Answer: New Patient Forms or Intake Forms

Explanation:
New patient forms have one purpose: to gather enough information about the patient's habits, general health, medical history, allergies and other information that will enable the medical organization to provide effective and safe treatment for the patient.

Often the forms provide information about the patient's rights and the responsibilities of the medical organization in administering health care to the patient.

Sometimes, new patient forms ask permission to obtain medical data from other medical organizations that had provided medical services to the patient.
 
4 0
3 years ago
A period in a man’s life, usually during his 70s or 80s, when testosterone decreases, causing a decrease in spermatogenesis, is
kolezko [41]
Answer: Andropause
I hope it helps
6 0
3 years ago
What biomolecule is useful for a fast source of energy?
MissTica

Carbohydrates are useful for a fast source of energy.

<h3>What are Carbohydrates?</h3>

The body swiftly breaks down simple carbs for use as fuel. Natural sources of simple carbs include fruits, milk, and dairy products. They can also be discovered in sugars that have been processed and refined, such as confectionery, table sugar, syrups, and soft drinks.

<h3>What food is in carbohydrates?</h3>

A vast variety of both good and bad foods, including bread, beans, milk, popcorn, potatoes, cookies, spaghetti, soft drinks, corn, and cherry pie, include carbohydrates. They can take on various shapes as well. It is prevalent and plentiful in starches, fibers, and sugars.

<h3>What are examples of the three types of carbohydrates?</h3>

The three forms of carbohydrates—sugar, starch, and fiber—often referred to as simple or complex carbohydrates, each has a role in your diet. Sugar is a simple carbohydrate made up of mono- and disaccharides. Polysaccharides are complex carbohydrates, which include fiber and starches.

To learn more about carbohydrates visit:

brainly.com/question/14614055

#SPJ4

3 0
2 years ago
Other questions:
  • Which of the following statements about viruses is false?
    7·1 answer
  • Which life characteristic describe a long-term response to the environment
    14·2 answers
  • What do boys like the most about girls
    14·1 answer
  • in a tropical rain forest,the layer formed by the leafy tops is called the ____ and the layer of shorter trees and vines are cal
    6·1 answer
  • Which of the following describes a person swinging a bat?
    5·2 answers
  • Explain why Aristotle's system of classifying animals is no longer used by biologists?
    6·1 answer
  • Earthquakes produce what three type of waves
    13·1 answer
  • What are sedimentary rocks that form from evaporating sea water called?
    12·1 answer
  • Help please for both <br> i’ll mark brainlist
    10·2 answers
  • Which phrase describes a nuclear chain reaction?(1 point)
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!