Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
the liver is inferior
Explanation:
Your heart is above your liver so your heart is superior to your liver and your liver is inferior to your heart(i think that's how it works)
According to Selye's theory of stress, during the condition of the stress, the body undergoes the general adaptation syndrome, which occurs in three stages. These three stages are fight or flight, resistance reaction, and exhaustion.
The flight or fight reaction is stimulated by the hypothalamus. It results in the excitement of the sympathetic division of the autonomic nervous system. The resistance reaction is caused by the hormones released by the hypothalamus; this is long lasting and provides ATP (adenosine triphosphate) molecules for the counter reaction to the stress.
As the result of use of ATP and other energy resource from body during the resistance reaction, the body becomes deprived of energy. This causes the exhaustion in the body.
So, the resistance phase of the stress expands a considerable amount of energy, which causes exhaustion.
