1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ioda
3 years ago
11

On the map, which letter represents the country that was MOST affected by the Green revolution?

Geography
2 answers:
vekshin13 years ago
6 0

Answer:

l\yes your right it is b great job

and i took the test

Explanation:

lys-0071 [83]3 years ago
4 0

Answer:

Letter B - India/Pakistan

Explanation:

The venue of the Green Revolution in India allowed to prevent a massive famine in India and Pakistan in the early 1960's, saving a great number of people in this second most populated country of the world.

A Mexican research team introduced a new variety of wheat in India during that period and that earned them a Nobel Prize in 1970.

You might be interested in
You travel to the northwest part of the United States, you can see the
irinina [24]
The cascade volcanoes were formed by the subduction of the Juan De Fuca, Explorer and the Gorda Plate (remnants of the much larger Farallon Plate) under the North American Plate alone the Cascadia subduction zone
3 0
3 years ago
In the early twentieth century, Alfred Wegener proposed the continental drift hypothesis. He thought the continents had once bee
Marizza181 [45]

He claimed that they were one large supercontinent called Pangaea.  His evidence for his claim was that the general shapes of the separate continents and how they can fit together if you arrange them. He noticed patterns in the mountain ranges; when all the continents are together the ranges line up with one another.

4 0
4 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
4. Which country is shown as having only one resource!
marshall27 [118]

Answer  South Sudan

Explanation:

6 0
4 years ago
The archaeologists’ term “correlated age” means
nasty-shy [4]
It means similarities between two or more things... Is that what you were looking for?
6 0
4 years ago
Read 2 more answers
Other questions:
  • Why is legal equality important to the free interprise system?
    13·2 answers
  • what are the most culturally diverse places in Latin America? A. the rural areas B. the mountains C. the lowlands D. the cities
    6·1 answer
  • How did plants change the earth 2 billion years ago?
    8·2 answers
  • Por favor ayúdenme a contestar estas pregunta cada una de 80 palabras por lo menos ¿Crees estar inserto en un mundo globalizado?
    10·2 answers
  • What is poverty ? which is biggest challenge for poor people ? ​
    13·1 answer
  • The temperature of the air is 26 ∘C at sea level, use the average lapse rate to calculate the expected temperature at the top of
    8·1 answer
  • Name three lakes in Canada.
    15·2 answers
  • Help plz thank you<3
    9·1 answer
  • What is the measure of AngleJHG?
    14·1 answer
  • Which of the following functions is graphed above
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!