1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lyudmila [28]
3 years ago
7

20 POINTS!

Biology
2 answers:
Flauer [41]3 years ago
3 0

Answer:

fals tru true

Explanation:

gtnhenbr [62]3 years ago
3 0
False , true,true,true
You might be interested in
The view on life that is the result of rethinking and research on older adults is best described as? group of answer choices con
Rus_ich [418]

Answer: The view on life that is the result of rethinking and research on older adults is BEST described as: Multidimensional.

Explanation:

6 0
2 years ago
Describe the three types of predation and give an example of each.
uranmaximum [27]
<span>True predation is when a predator kills and eats its prey. Some predators of this type, such as jaguars, kill large prey. They tear it apart and chew it before eating it. Others, like bottlenose dolphins or snakes, may eat their prey whole. In some cases, the prey dies in the mouth or the digestive system of the predator. Baleen whales, for example, eat millions of plankton at once. The prey is digested afterward. True predators may hunt actively for prey, or they may sit and wait for prey to get within striking distance. In grazing , the predator eats part of the prey but does not usually kill it. You may have seen cows grazing on grass. The grass they eat grows back, so there is no real effect on the population. In the ocean, kelp (a type of seaweed) can regrow after being eaten by fish.</span>
3 0
3 years ago
The spinal cord is made up of
skelet666 [1.2K]

Answer:

Grey and White Matter.

Explanation:

When looking at an image of trasnverse section of the spinal cord the grey matter is almost butterfly shapped and it has the central canal in the middle. The white matter is surrounding the butterfly shaped, grey matter.

4 0
3 years ago
Read 2 more answers
Santos and Lüderitz are the same distance from the equator, and both cities
Hoochie [10]

Answer:

The difference in altitude between these two regions.

Explanation:

As you can see in the question above, Lüderitz and Santos are two regions that are the same distance from the equator, which indicates that the two regions have the same latitude and are in tropical zones. In addition, the two regions are close to the ocean, but the air in Lüderitz is cooler.

This indicates that there is a difference in altitude in these regions and Lüderitz has a higher altitude than Santos, which is why Lüderitz's air is colder and Santos's is hotter.

Altitude is a geographic term that represents the distance of a region in relation to the level of the sea. The higher the altitude, the greater the distance.

The higher the altitude of a region, the colder its air will be. This is because in high altitude regions, air is thin and has a small capacity to retain heat.

5 0
3 years ago
What do you think the term gene expression means? How do you think the term relates to the total number of genes a human inherit
Gnesinka [82]

The process by through which the instructions that are present in a DNA is transformed into proteins is called gene expression.

The term is related to to the total number of genes that are inherited from the parents in such a way that a gene contains many information related to the building of proteins and hormones that are necessary for the human growth.

<u>Explanation:</u>

The term Gene expression refers to the transfer of the DNA instructions into proteins. It is the main process that helps a human body responding to the varying environment. It is the main factor that controls and regulates the amount proteins production. The steps transcription and translation is involved in the protein production process

The traits from the parents of an individual like blood group type, color of eye are passed to their children. These are passed through genes. These also passes some diseases also. A gene contains information related to the amount of hormones and proteins to be produced which is done by the gene expression.

5 0
3 years ago
Read 2 more answers
Other questions:
  • How many would you expect to meet the critera for hypertension?
    13·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What is the difference between refraction and reflection
    14·1 answer
  • Which of the following describes mass
    12·1 answer
  • Which two types of rocks make metamorphic rock?
    15·2 answers
  • Slow development or replacement of an ecological community by another over time
    6·1 answer
  • What does anerobic mean
    9·1 answer
  • Ang____ ay pagbabago ng isa o higit pang mga pisikal na katangian ng bagay​
    13·1 answer
  • What do you do when you lost 99% of your brain cells? -Lily
    5·2 answers
  • Lizette and her husband had her ova fertilized with his sperm in a laboratory and then implanted in her uterus. what form of ass
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!