1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hodyreva [135]
3 years ago
7

A scientist discovers a new species of eukaryotic organisms living in a small pond. The organism is unicellular and autotrophic,

but it has flagella that allows it to move on its own. To which kingdom does this organism belong?
A. Plantae
B. Fungi
C. Eubacteria
D. Protista
Biology
1 answer:
abruzzese [7]3 years ago
8 0
C hope u do great I’m really sorry if I’m wrong
You might be interested in
What is the correct structure for 7-bromo-5-octyn-3-one?
Ede4ka [16]
The correct structure is shown below,

According to rules the longest carbon chain is selected, and numbering is started from side nearer to carbonyl group. As the parent name goes to ketone, so among alkyne and halogen second priority is given to alkyne and 3rd to halogen

So, the name shoul carry following words,

3- one (for ketone)

5-yne (for Alkyne)

7-Bromo (for Halogen)

Result:
           So the structure is as follow,

4 0
3 years ago
CELL GRAPHIC ORGANIZER
motikmotik

Answer:

A vacuole is a membrane-bound organelle. They are a kind of vesicle. Vacuoles are closed sacs, made of membranes with inorganic or organic molecules inside, such as enzymes. They have no set shape or size, and the cell can change them as it wants.

Explanation:

Water is predominantly found in cell sap. It serves as a storehouse for the plant cell to act as a storage place for excess nutrients. A vacuole is a membrane-enclosed fluid filled sac.

7 0
3 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
HELP PLZZ!!!!!!!
Alla [95]

Answer:

1.C, 2.B ,3A

Explanation:

5 0
3 years ago
Read 2 more answers
Explain why an ecological pyramid is smaller at the top then the bottom
pentagon [3]
The ecological pyramid is smaller at the top due to the lower amount of species to fit into the category (diversity is decreased, and the higher, the more suppressed the energy is in the animals/species).
3 0
3 years ago
Other questions:
  • A lizard lives in a desert. Which would be an adapation for this lizard?​
    9·1 answer
  • Name two different methods for evaluating evidence. Compare and contrast these two methods?
    8·1 answer
  • In a person with super male syndrome, the 23rd chromosome pair looks like ________.
    15·1 answer
  • Most likely, a woman who desires to terminate her pregnancy at the eighth week will undergo a culpotomy. vacuum aspiration. dila
    7·2 answers
  • How the does the shape of an enzyme affect the reaction?
    7·1 answer
  • What was the independent variable in Francesco Redi's experimental setup?
    9·2 answers
  • Explain the difference between weathering and erosion
    6·1 answer
  • An 18-year-old client who has reached 16 weeks of gestation was recently diagnosed with pregestational diabetes. She attends her
    11·1 answer
  • As scientists, politicians and concerned citizens recognize the threat of global warming to the ongoing climate change, reductio
    8·1 answer
  • Are the oldest rock on the highest or lowest stratum?​
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!