1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kati45 [8]
3 years ago
15

Why would a plant store energy in the form of sugars using photosynthesis when the plant can make an unlimited number of ATP thr

ough the light reactions?
Biology
1 answer:
AysviL [449]3 years ago
4 0

Answer: They store energy because they may need it for winter. Take pine trees for example. They are fine through the winter because they have stored enough energy to keep their leaves. this works with regular trees to. The reason why trees don’t die in winter is because they store energy to last.

Explanation: Plants can’t use photosynthesis without light

You might be interested in
Please answer fast ASAP I give brainliest <br><br><br> All you need is on the photo
lys-0071 [83]
B: a molecule within DNA
3 0
2 years ago
Primary storage site for most fat soluble vitamins
Monica [59]
This happens mostly in the adipose and liver.
5 0
3 years ago
How many groups did Aristotle use to divide all of the organisms in the world?
Serhud [2]
Aristotle based his classification system off of observations of animals, and used physical characteristics to divide animals into two groups

7 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
What are the Independent (IV) and the Dependent Variable (DV) in this hypothesis?
Alexeev081 [22]

Answer:

the dependent is how fast the coronavirus spreads. independent is whether the person works in a public space or not

4 0
2 years ago
Other questions:
  • No longer existing or living
    5·1 answer
  • Amino acids are linked together to make proteins by removing a molecule of _____ in a process called _______
    10·2 answers
  • Explaining of matter when it is heated known as
    12·2 answers
  • Match the term with the appropriate definition
    5·1 answer
  • Which conditions describe the neritic zone? check all that apply
    11·1 answer
  • Located at the top of the trachea, the _____ helps a person speak.
    12·1 answer
  • differentiate between Picture Plant mushroom and order on the basis of stem leaf and water requirement​
    5·1 answer
  • Which of the following accurately describes an example of a vestigial structure?
    9·1 answer
  • Please Answer FAST ASAP
    12·2 answers
  • Complete the following equations<br> 1)Glucose+fructose<br> 2)Maltose+water
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!