1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andru [333]
3 years ago
14

A biologist is using a dichotomous key to identify fish. 1. (a) Has a single dorsal fin ® 5 (b) Has a double dorsal fin ® 2 2. (

a) One fin is spiny, the other is smooth ® 3 (b) One fin is not spiny or smooth ® 4 5. (a) Has small fin on back near tail ® 6 (b) Has no fin on back near tail ® 7 6. (a) Has barbs near the mouth ® Catfish (b) Does not have barbs near the mouth ® 10 7. (a) Tail is asymmetrical ® 8 (b) Tail is symmetrical ® 9 10. (a) Scales are small ® Trout (b) Scales are large ® Whitefish What is the next step to take to identify a fish that has a single dorsal fin and no fin on the back near the tail? step 5 step 2 step 7 step 6 Mark this and return
Biology
2 answers:
Fantom [35]3 years ago
4 0

Answer:

Step 7

Explanation:

Lina20 [59]3 years ago
3 0

Answer:

step 7

Explanation:

it was on quizlet

You might be interested in
Is alcohol addiction biologically determined or culturally influenced?
tresset_1 [31]
I believe alcohol addiction is related to males who's father's were alcohol addicted. this condition is due to hereditary DNA. Studies have proven more males than females suffer from this addiction.
5 0
3 years ago
Different environments can be affected by various types of pollution. How would bacteria and algae in a pond kill fish and other
makvit [3.9K]
The polluted bacteria and algae interacts with fish and other aquatic wildlife, so they will be negatively impacted by that relationship in this case.
8 0
3 years ago
Question 11 (1 point)
pishuonlain [190]
A different form of a gene
3 0
3 years ago
What is one way to separate a substance that is dissolved in water?
Illusion [34]

Answer:

Mixtures can be separated using a variety of techniques. Chromatography involves solvent separation on a solid medium. ... Evaporation removes a liquid from a solution to leave a solid material. Filtration separates solids of different sizes.

7 0
3 years ago
Read 2 more answers
List the order of the reactions to metabolize glucose?
FromTheMoon [43]

The metabolism of glucose involves the breakdown of glucose molecules to form the needed energy by the cell called ATP.The process follows the order of;

1.Glycolysis

2.Citric acid cycle

3.Oxidatize phosphorylation.


7 0
3 years ago
Other questions:
  • What does it mean when the mother did not drink alcohol before getting pregnant, but then started to drink while pregnant?
    6·1 answer
  • Tyler want to learn about the types of insects in the soil near his house. Which would be a benefit of carrying out a descriptiv
    10·2 answers
  • What are polar molecules
    12·1 answer
  • What should a literary analysis contain?
    14·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What are the 3 most important parts of a seed
    14·2 answers
  • Why is exposure more harmful to the fetus than mother
    9·1 answer
  • ¿Crees que el cromosoma Y contiene genes que son críticos para la supervivencia de un organismo? Explica tu razonamiento
    6·1 answer
  • The fossils that scientists find and study today formed thousands to millions of years ago. But, you can simulate the process of
    12·2 answers
  • Which biome is predominant throughout South America, Africa,<br> and South and Southeast Asia?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!