1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vovangra [49]
3 years ago
5

A black monkey eating write one scientific question about the organism in the photo​

Biology
1 answer:
Anit [1.1K]3 years ago
3 0

Answer:

Why is the monkey black?

Explanation:

You might be interested in
The combined genetic information of all members of a particular population forms a ________.
Dafna1 [17]
The combined genetic information of all members of a particular population forms a <span>gene pool</span>. The answer to your question is B. I hope this is the answer that you are looking for and it comes to your help.
5 0
3 years ago
14. Gout is the crystallization of what acid?<br> Amino<br> Uric<br> Sulfuric<br> Acetic
omeli [17]

Answer:

uric

Explanation:

3 0
3 years ago
How are hydrogen bonds different from covalent bonds?
Katyanochek1 [597]
Hydrogen bonds are weaker than covalent bonds.
3 0
4 years ago
Why does every one have cells
jeyben [28]
<span>Everyone has cells because these are the building blocks of life. These tiny particles that clump into groups that form tissues, organs, and organ systems are what makes organisms distinct from non-living things that exist on Earth. Where there are cells, life is present, and in its absence life cannot exist as we know of today. Cells are responsible for bringing different species of organisms that are found in different ecosystems all over Earth. They are tiny but in groups they are responsible for every living organisms that have existed through time.  </span>
7 0
3 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
4 years ago
Other questions:
  • Why are leaves green and in what cell organelle is it stored
    15·2 answers
  • How to gain teens trust for medical reasons?
    11·1 answer
  • Cells are ___________
    5·1 answer
  • Cuántas cifras significativas tiene la siguiente cifra 9000?
    6·1 answer
  • What is the key lesson learned from Easter Island?
    10·1 answer
  • What would happen if someone was not able to produce enough amylase?
    9·1 answer
  • Does each daughter cell have the same genetic makeup as the original cell? Explain.
    5·1 answer
  • which aspect of el nino can give scientists a preview of earth as temperatures rise with global warming?
    9·1 answer
  • Which face of the mountain is typically warmer?<br> East or West
    9·2 answers
  • A student creates a model of a calendar to show the phases of the Moon in January.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!