The combined genetic information of all members of a particular population forms a <span>gene pool</span>. The answer to your question is B. I hope this is the answer that you are looking for and it comes to your help.
Hydrogen bonds are weaker than covalent bonds.
<span>Everyone has cells because these are the building
blocks of life. These tiny particles that clump into groups that form tissues,
organs, and organ systems are
what makes organisms distinct from non-living things that exist on Earth. Where
there are cells, life is present, and in its absence life cannot exist as we
know of today. Cells are responsible for bringing different species of
organisms that are found in different ecosystems all over Earth. They are tiny
but in groups they are responsible for every living organisms that have existed
through time. </span>
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
