1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna71 [15]
3 years ago
14

PLEASE HELP ITS DUE TOMORROW

Biology
1 answer:
Lena [83]3 years ago
8 0

Answer:

good luck on that one... ........... ..

You might be interested in
1)What does the term Science means to you as a student?​
BaLLatris [955]

Answer: 1 : knowledge about the natural world that is based on facts learned through experiments and observation. 2 : an area of study that deals with the natural world (as biology or physics)

Explanation:

4 0
3 years ago
Read 2 more answers
The ultimate purpose of respiration:
pshichka [43]

Answer:

if ur asking which one of those answer choices is the right one, it's D! Deliver oxygen to every blood cell <3

Explanation:

This involves transport of oxygen from the lung to the tissues by means of the circulation of blood.

7 0
3 years ago
Read 2 more answers
What is name given to the regularly spaced infoldings of the sarcolemma?
nikitadnepr [17]

There isn’t exactly a name for it other than “folded sarcolemma”, however, the end of the motor neuron does extend some projections into these spaces.

5 0
3 years ago
Maribel places her backpack and lunch bag on a lab table where there are lab materials. What is the safest way for Maribel to ar
Veronika [31]

Answer:

she should arrange them away from lab materials. She could put them to the side or under the table

Explanation:

3 0
4 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Other questions:
  • Rachel Carson’s warning in Silent Spring was focused on _______.
    12·2 answers
  • Approximately how much time passes between H and B?
    13·2 answers
  • PLEASE HELP!!! ASAP 30 POINTS!!
    5·1 answer
  • It is possible for evolution to be influenced by choices that individuals make concerning which individual to mate with or even
    15·1 answer
  • Red blood cells carry __________ to the lungs and __________ to the tissues.
    6·1 answer
  • How will genome projects contribute to better productivity in cattle?
    10·1 answer
  • What is the opening in the mouth airway of a frog?
    7·1 answer
  • If a system requires 150 J of input work and produces 123 J of output work, what's its efficiency?
    9·1 answer
  • How is ocean acidification different from climate change?
    7·1 answer
  • Which is NOT a similar function of all cells?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!