1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ahrayia [7]
2 years ago
9

Please help due today!! Brainliest given !!

Biology
1 answer:
Misha Larkins [42]2 years ago
5 0

Answer:

The theory of evolution first formulated in Darwin's book is the process by which organisms change over time as a result of changes in heritable physical or behavioral traits that allow them to better adapt to its environment, survive and have more offspring.

Ernst Mayr divided Darwin's theory into 5 unique parts.

Ernst Mayr divided Darwin's theory into 5 unique parts.Evolution as such

Along with Buffon and Lamarck, Darwin supported the ability of species to change over time.

Common Descent

Darwin felt that all of the diversity of life on earth emerged out of the evolution from one or a few common ancestors.

Gradualism

While Lamarck felt that species-wide change could take place within the span of a few generations, Darwin felt evolution was a much slower process, taking place in innumerable small steps.

Population Speciation

This portion of Darwin's theory states that within a population, change in a species occurs as the balance of hereditary characteristics shifts across that population. This differs from Lamarck's idea that each individual in the population must undergo the same change. According to Lamarck, all giraffes living under tall trees would develop long necks. According to Darwin, some would randomly be born with long necks, this hereditary trait would gradually spread throughout the population.

Natural selection

Natural selection is often called the most unique part of Darwin's theory. Competition had been thought of as a reason that a given species might succeed or go extinct, but Darwin extended the understanding to change within a species. To continue the example of giraffes: when a giraffe is born with a longer neck than its fellows, it gains an advantage because it is able to reach more food. The long-neck giraffe is therefore stronger, lives longer, and more likely to have offspring. These offspring are born with the same long neck as their parent, though some might have even longer necks.

Returning to the example in the figure, in the first generation the application of the pesticide causes the death of most of the non-resistant insects: only those resistant to the pesticide survive. These insects reproduce and maintain their resistence so that the second generation will be more resistant than the first. So we have Natural selection, speciation, gradualism and evolution in act all together.

You might be interested in
Which of these is least likely to be an adaptation of an organism to its environment?
Mkey [24]

Answer:

The correct answer is "C. Cave fish have evolved degenerated eyes because they have no use for vision in dark, underwater caves."

Explanation:

All of these statements about organism adaptation to its environment are true, but the real reason why cave-fish are blind is not because there's no use for their eyes in the dark, but because being blind saves them energy, as using one's vision requires the activity of photoreceptive cells and neurons, and underground caves are lacking in both food and oxygen.

4 0
3 years ago
//ANSWER ASAP!//
fgiga [73]

Answer:

consistent warm weather

Explanation:

8 0
2 years ago
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
Which particles is the fundamental unit of all matter in both living and nonliving
erica [24]

Answer:

atoms

Explanation:

all things in the universe are made of atoms and they are considered the fundamental unit of matter.

non-living things are composed of different compounds and molecules.

living things are made of cells, and cells themselves are made of different molecules. So living things are also made of atoms.

5 0
3 years ago
What is the difference between a sound intensity, volume pitch and frequency
Fynjy0 [20]
Sound intensity is the intensity/volume of sound. Frequency is how high or low the sound is.
4 0
3 years ago
Read 2 more answers
Other questions:
  • Describe polygenic inheritance and give an example.
    5·1 answer
  • The pH of coffee is _______ times greater than the pH of pure water.
    12·2 answers
  • Compare the amount of ATP made during aerobic cellular respiration to the amount of ATP made during anaerobic cellular respirati
    13·1 answer
  • Malonate is a competitive inhibitor of succinate dehydrogenase. If malonate is added to a mitochondrial preparation that is oxid
    11·1 answer
  • Which of the following would accompany a high-protein meal moving through the digestive system
    9·1 answer
  • Lulu and nana are not transgenic, but they are genetically modified. Explain the difference. Also explain how every cell in thei
    10·1 answer
  • Which most accurately describes the difference in
    10·1 answer
  • 2) How many solutions does the equation 4x + 2(x-5) = 3(2x - 4) have? Write down the final form as well as if it has no solution
    13·1 answer
  • Task 1
    6·1 answer
  • The MOST distinctive feature of ape dentition, which clearly distinguishes apes from Old World monkeys, is
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!