1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jeka94
3 years ago
15

Explain the theory of plate tectonics and how they have changed earths surface over time. include the role of plate tectonics in

the creation of landforms
(in your own word i will mark branniest if you give me your own words)

and is worth 40 points and i will delete answers that don't match the question
Biology
1 answer:
aniked [119]3 years ago
7 0

Answer:

According to plate tectonics theory, Earth's outer shell is divided into multiple plates that slowly glide over the mantle. This slowly changes Earth's surface over time by merging, or separating, continents.

You might be interested in
Due today i have a C and need to bring my grade to a B and will mark brainliest
Ostrovityanka [42]

Answer:

-What types of toxins were found in the waters of the Lower Passaic Superfund site?

DDT and agent orange were found in the waters of the Lower Passaic Superfund site.

-How were some fish able to survive PCB levels thousands of times higher than sensitive fish can withstand?

in some tolerant fish, the trigger for the changes that can be caused by PCB levels are can be turned off which allows some fish to survive levels of PCB thousands of times higher than the levels affecting sensitive fish.

-What is the advantage of a large population for rapid evolution?

The advantage of rapid evolution is that the animals can survive and not get killed off.

-Do you think all species would be able to evolve adaptations to help them survive pollutants? Why or why not?

I don't think that all fish can get speedy evolutions like the killfish did because researchers think that they got a rare mutation which helped them survive. However as researchers say, in smaller populations with less diversity the chances that a rare mutation might happen is small.

-What will likely happen to these toxin-adapted fish if the waters are eventually cleaned up?

Once the water becomes clean, a tolerant fish with the mutation won't do as well as a sensitive fish would do.

Explanation:

Can I have brainliest? It would help me out, if not thanks anyways! Hope this helped and have a nice day! Thank you : )

4 0
3 years ago
An additional diagnosis that describes a condition arising after the beginning of hospital observation and treatment and then mo
DanielleElmas [232]
Comorbidity
2 diagnosis’s
5 0
3 years ago
Read 2 more answers
A human blood cell is placed in fresh water. As a result, water moves _____ the cell
Nuetrik [128]

Answer:

inside

Explanation:

osmosis is where water moves from high water conservation(outside of the cell) to a low water concentration(inside the cell) through the memebrane.

7 0
3 years ago
Read 2 more answers
What is the weight of the ethyl alcohol that exactly fills a 200.0 mL container? The density of ethyl alcohol is 0.789 g/mL.
bogdanovich [222]

Answer:

What is the weight of the ethyl alcohol that exactly fills a 200.0 mL container? The density of ethyl alcohol is 0.789 g/mL. g = (0.789 g/mL) (200.0 mL) = 158 g

Explanation:

<em> I looked it up on google. Im honestly not sure but i hope this helps.</em>

3 0
3 years ago
Function of epiglottis​
Butoxors [25]

Answer:

prevents secretion of upper air passage

Explanation:

to prevent foods and drinks from falling down the airway which is called aspiration and may lead to pneumonia

7 0
2 years ago
Other questions:
  • Penguins and orcas are both black and white, have developed fins for rapid swimming and are able to tolerate cold water, but pen
    10·2 answers
  • The most common type of electronic evidence is
    9·1 answer
  • What would be the most likely result of the death of all creosote bushes in the Mojave Desert? More coyotes More red-tailed hawk
    7·2 answers
  • Even with large quantities of food available, people in the United States can experience diseases such as heart disease, stroke,
    14·1 answer
  • Know as the coldest biomes? ​
    14·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • The products of photosynthesis are carbohydrates and oxygen. Which process uses these substances as reactants ?
    8·2 answers
  • Deep, cold water is the __________. Warm, shallow water is the ___________.
    8·1 answer
  • After several miles of running and sprinting in intervals, the runner’s muscles ache and feel fatigued. Which is the best explan
    11·2 answers
  • A neap tide is when the tides have a big difference between high and low tide. *
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!