Which type of electromagnetic wave has the lowest frequency?

Biology

2 answers:

Zielflug [23.3K]3 years ago

7 0

Answer:

radio waves

Explanation:

radio waves are waves in the electromagnetic spectrum that have the longest wavelengths and lowest frequency.

sveta [45]3 years ago

7 0

Option D,
Explanation: Simply searched it up

You might be interested in

What is a feed back mechanism in the human body

ser-zykov [4K]

Your nerves send feedback to the brain to tell you what you are touching. I suppose that is a feedback mechanism. I dunno if it is entirely helpful.

3 0

3 years ago

The alleles for height are labeled T for tall and t for short. If the resulting plant is tt, it will be _____. Question 11 optio

lesya692 [45]

B) short because it has both t alleles and no T alleles

5 0

3 years ago

Why are indexes better than simple measurements for comparing fossil specimens?

timurjin [86]

They are better because they are for comparative use for instance hair color to finger nails they both grow but onto separate parts of the body.

Hope this helps [:

5 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

Which is an example of a population?

JulijaS [17]

Well lets see here, The definition of population is a particular section, group, or type of people or animals living in an area or country. So it would be D.<span>
</span>

5 0

3 years ago