1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vfiekz [6]
3 years ago
8

Which is all of the organisms found on earth and all of the areas in which they live

Biology
2 answers:
Elza [17]3 years ago
8 0

Answer:

Biosphere

Explanation:

I took the test and got it right. Hope this helps!

kirill115 [55]3 years ago
7 0

Answer

ecosystem

Explanation:

because a biome is s a collection of plants and animals that have common characteristics for the environment they exist in. They can be found over a range of continents. Biomes are distinct biological communities that have formed in response to a shared physical climate.

You might be interested in
According to PET scan results, what do cocaine addicts process less efficiently?
BabaBlast [244]
Positron Emission Tomography scan of the brain of cocaine addicts showed that the drug affects how the brain use glucose. Cocaine users' brain cannot use glucose efficiently and there are also reduced metabolic activity in other areas of the brain.
3 0
3 years ago
Which of the following gases is formed during photosynthesis?
katrin2010 [14]

Answer:

oxygen

Explanation:

6 0
2 years ago
A child has type O blood. Which of the following couples could be the child's parents?
Fofino [41]

Answer:D Is the correct answer.

Explanation: All of the options could be the parents of the child with type O blood, because every type of blood has an O type in it.

3 0
3 years ago
By increasing the height of an inclined plane, work is made easier.<br><br> True or false
umka2103 [35]

Answer:

False.

Explanation:

You have to push harder.

4 0
2 years ago
Read 2 more answers
3
Ber [7]
I believe the answer is a and d and b not 100% sure
5 0
3 years ago
Other questions:
  • Can you check my work for this worksheet?
    8·1 answer
  • Which of these is required for natural selection to happen?
    6·1 answer
  • Why is it beneficial for a parasite to allow its host to live?
    5·1 answer
  • PLEASE HELP!!! Easy question, extra points!!!
    5·2 answers
  • Why does it make sense to use the word translation to describe protein synthesis anf why it would not make sense to use the word
    12·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • How is Pluto more like Quaoar and Sedna than it is like Neptune ?
    5·2 answers
  • How many grams of O2 are needed to completely react with 2 moles of N2 ? Enter your answer as a number (do not enter the units o
    15·1 answer
  • Why are land resources beneficial?
    10·1 answer
  • All cells share common traits that help scientists draw conclusions about the basic needs and functions of living organisms. Wha
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!