1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sleet_krkn [62]
3 years ago
14

The nurse is caring for a client who has been prescribed humidified oxygen at 6 l/minute. which type of liquid will the nurse ga

ther to set up the humidifier?
Biology
1 answer:
Oduvanchick [21]3 years ago
8 0
The liquid needed for oxygen humidifier would be sterile water.

When administering a high dose of oxygen(>6lpm) it is important to use a humidifier so the air that enters the lungs is humid enough so it won't dry the airway. Sterile water is best because there is a chance that bacteria from water will enter the airway. Impurities in water are not harmful to the body but it might damage the machine, so distilled water would be best.
You might be interested in
What is not a primary cause of eroding rock?
Artemon [7]
Wind because its not mechanically eroding them..
4 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
4 years ago
Juan and joaquin are identical twins. they are the result of _____.
natta225 [31]
<span>Identical twins are the result of an egg being fertilized by one sperm and then splitting, creating two eggs with identical genetic information. Non-identical twins are formed when two eggs are fertilized by two separate sperm and develop together in the uterus with unique genetic information.</span>
8 0
3 years ago
(blank) is the thermal energy that flows from one substance to another when the substances differ in temperature.
ladessa [460]

The thermal energy can be defined as the type of kinetic energy which is generated due to the motions of the particles. This motion generates a temperature which can be measured easily. The type of thermal energy which flows from one substance to another when the temperature of the two substances is different is known as heat.

Hence, the blank can be filled with 'heat'.

6 0
3 years ago
Read 2 more answers
you are studying a bacteria plasmid that contains 5 operons and 15 genes. how many transcriptional promoters are on this plasmid
mojhsa [17]

Numerous catabolic operons have their transcription controlled by glucose. The three enzymes needed for conversion are encoded by the operon's five structural genes.

<h3>How many genes are there in an operon?</h3>

Operons have a transcription promoter at the beginning, two to twelve genes on average, and a transcription terminator at the conclusion (Zheng et al. 2002; Lawrence 2003).

<h3>Yes, there is just one promoter for operons.</h3>

An operon is a group of genes that all use the same transcriptional promoter. Every operon contains regulatory DNA sequences that act as binding sites for regulatory proteins that either promote or inhibit transcription.

<h3>The promoter is a 3 or a 5?</h3>

An area of DNA known as a promoter is where RNA polymerase starts to transcribe a gene. Promoter sequences are often found directly in the genome.

To know more about transcriptional promoters visit

brainly.com/question/12700084

#SPJ4

4 0
2 years ago
Other questions:
  • A doctor who specializes in diagnosing and treating diseases and disorders of the eyes and vision.
    15·1 answer
  • PLZ HURRY IT'S URGENT!!!!
    9·1 answer
  • Which of these is a process by which water, carbon dioxide, and energy are formed?
    9·2 answers
  • How much energy would be available to the next levels of the food chain?
    9·1 answer
  • Science help pls,, thank
    12·1 answer
  • We live in the Cenozoic era, and scientists know more about this era and the epochs it's divided into than any other time period
    9·1 answer
  • Which of the following is not part of Earth's physical systems? *
    12·1 answer
  • What does absorption mean? A. breakdown of molecules B. enzyme activity on nutrients C. network of chemical reactions that occur
    13·1 answer
  • ______ 8. The patterns of dispersion illustrated in the figures above are similar in that they all reflect interactions between
    14·2 answers
  • SAQ-1:How do you take care of your own clothes
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!