What is the MAIN purpose of the Clean Water Act (CWA)?

1 answer:

6 0

The Clean Water Act (CWA) establishes the basic structure for regulating discharges of pollutants into the waters of the United States and regulating quality standards for surface waters. The basis of the CWA was enacted in 1948 and was called the Federal Water Pollution Control Act, but the Act was significantly reorganized and expanded in 1972. "Clean Water Act" became the Act's common name with amendments in 1972.

You might be interested in

What is a sex linked trait? What is the difference in inheritance between boys and girls for sex linked traits? Describe an exam

Romashka [77]

A sex-linked trait is a trait that is carried by the X chromosomes in females but it is not expressed(the phenotype). Females are only carriers because they have two copies of the X chromosome [one of them carries the trait and the other does not]. Males who inherit one copy of the X chromosome often get the trait (because the trait is in either one copy or the other of the X chromosome) and express it while their Y chromosome would became recessive. Thus, only males express sex-linked traits such as hemophilia or color blindness

8 0

3 years ago

What membrane protects the brain and spinal cord that circulates cerebral spinal fluid (csf) g?

nata0808 [166]

Meninges are membranes that cover and protect the brain and spinal cord.
There are three layers of meninges: Dura mater (closest to the bone), Arachnoid loosely around the brain, Pia mater is closely attached to the brain and spinal cord surface.

5 0

4 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

A uranium-235 sample starts with 200 atoms, and 700 million years later,

Solnce55 [7]

I think it 700 million years because I took the same question and that’s what I put.

3 0

3 years ago

With advancing age, the lymphatic system ________.

Pepsi [2]

The right answer is D (less responsive to antigens)

It is proven that, after puberty, thymus activity (an organ that is included in the lymphatic system, producing T cells that pick up antigens) decreases and that in adult and aged people the thymus has no role. Work done in humans indicate that in fact the cellularity begins to decline from birth in favor of lymphocyte perivascular spaces and connective and adipose tissue, which leads to a decrease in the capture of antigens.

4 0

3 years ago