1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nikdorinn [45]
3 years ago
7

Give me 3 reasons Mitosis is essential to life (with an explanation)

Biology
1 answer:
Sveta_85 [38]3 years ago
7 0

Answer:

¿Por qué es importante la mitosis para los seres vivos?

La división celular por mitosis es decisiva para el desarrollo de los organismos y su reproducción; aunado a ello, es necesario que cada nueva célula sea genéticamente idéntica de la que proviene

Explanation:

You might be interested in
According to the Punnett square, offspring from these two parents have a ____________ chance of inheriting two b alleles. Indivi
aliina [53]

Explanation:

50%; homozygous recessive; phenotype

According to the Punnett square, offspring from these two parents have a <u>50%</u>chance of inheriting two b alleles. Individuals that inherit two b alleles are <u>homozygous recessive </u>. Inheriting two b alleles confers the <u>phenotype</u> of blue eyes.

Inheritance describes the way in which certain traits are passed onto offspring of sexual reproduction. For instance, co-dominance, both of a gene's alleles are present, and notable in the phenotype.

The nucleus is a large membrane-bound organelle that houses the genetic information, DNA, in the cell. Sequences of DNA make up genes which can have different forms called alleles and comprise the genotype. DNA is transcribed into mRNA and later translated into amino acids which are linked together by rRNA to form proteins. These proteins, when expressed, are referred to as an organism's phenotype.

Learn more about transcription at brainly.com/question/11339456

Learn more about DNA and RNA brainly.com/question/2416343?source=aid8411316

Learn more about proteins and carbohydrates at brainly.com/question/10744528

#LearnWithBrainly

3 0
3 years ago
Select all of the answers that apply.
olga_2 [115]

The answers are : C, B


I hope that's help:)

7 0
3 years ago
Read 2 more answers
A type of RNA that carries amino acids to the ribosome is
Semenov [28]
TRNA: transport/transfer rna
3 0
3 years ago
The flu viruses are a good example of virus evolution through: Group of answer choices genome reassortment. mutation. All of the
slega [8]
What's the overhead of a pharmacy in a year that it pays $474,900 in salaries, $24,000 in rental fees, $31,505 for utilities, $126,000 in inventory costs, $7,005 in computer system repairs, and has a depreciation rate of $12,110? a) $549,520 b) $675,520 c) $510,505 d) $644,015
7 0
3 years ago
3. What basic concept of biology includes the idea
Dafna1 [17]

Answer:

It would be the cell theory

5 0
4 years ago
Other questions:
  • A group of scientists working for the University of Florida commented on the lack of alligators in a swampy area around Jacksonv
    13·2 answers
  • How do scientists know that humans originated in Africa?
    13·1 answer
  • John Flashback was running downfield with the football. As he tried to avoid a tackle, he stepped in a hole and his foot was twi
    14·1 answer
  • Help please biology !!!
    8·2 answers
  • Which organelle would be highly prevalent in muscle and nerve cells?
    10·1 answer
  • Anyone have tips for taking care of bonsai??
    11·2 answers
  • Which correctly lists three factors that are important to consider when forecasting weather?
    7·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What causes cyclones to rotate counter-clockwise in the northern hemisphere and clockwise in the southern hemisphere?
    9·1 answer
  • B. Write five (5) ways on how to conserve water.Write your answers on a separate of paper.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!