1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yulyashka [42]
3 years ago
5

The red fox is a predator which feeds on the small mammals, amphibians, insects, and fruit. Red foxes are active at night. They

provide blood for blackflies and mosquitoes, and are host to numerous diseases. The scraps, or carrion, left behind after a fox's meal provide food for many small scavengers and decomposers. Is this an example of the red fox’s habitat or niche? Explain your answer.
Biology
1 answer:
lozanna [386]3 years ago
5 0
I don’t know I just need the points I hole u find the answer though(:
You might be interested in
What are some negatives and some positives of coastal development?
zzz [600]

Answer:  Positive: Coastal areas help prevent erosion; filter pollutants; and provide food, shelter, breeding areas, and nursery grounds for a wide variety of organisms.

Negative: Added to this are impacts such as increased erosion due to coastal development, increased pollution, and increased boat traffic - all of which lead to further habitat loss and put increased pressure on marine species. ... Other coastal developments can also harm sensitive marine habitats and species.

Explanation:

5 0
3 years ago
The instructions for the genetic traits of an organism are directly determined by the
Delicious77 [7]

The answer would be:

B. Sequence of the bases in DNA molecules.

Here is more about your questions:

DNA contain the instructions of the traits of an organism. Most of the organism have the same DNA but what makes each different is the sequence of the DNA. The sequence gives the instructions for the production of amino acid that will produce, which in turn determines what traits will be passed on or manifested by that individual.

8 0
3 years ago
Read 2 more answers
Help me find out the answers. thank you.​
lawyer [7]

Answer:

2.) C

3.)Traits & population

4.)A ,C, & D

3 0
3 years ago
the cell membrane of a red blood cell will allow water , carbon dioxide, oxygen and glucose to pass through. Because other subst
frosja888 [35]
Amino acids, sugars, and ions move<span> across </span><span>the cell membrane</span>
3 0
4 years ago
Which type of neuron is completely contained within the CNS?
ZanzabumX [31]
The answer is absolutely C
3 0
3 years ago
Read 2 more answers
Other questions:
  • From the surface of the Earth to about __________ (9 miles) above the surface
    13·1 answer
  • How are the respiratory system and the circulatory system connected.
    14·1 answer
  • What are three parts that create an amino acid
    14·1 answer
  • Special filtered masks are often required when caring for a client with known or suspected tuberculosis
    14·1 answer
  • What are the steps in SCNT? Order these steps so you can complete your own cloning project.
    6·2 answers
  • Explain the process of mitosis in a tissue culture for normal cells
    9·2 answers
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • How do you feel about the cellular respiration equation?
    10·1 answer
  • Which region would likely have the greatest amount of biodiversity?
    9·1 answer
  • Describe a time when you had to approach a complex problem by breaking it down into smaller parts that were easier to understand
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!